JHR 87: 323-480 (2021) er, JOURNAL OF eet snnscnn ne doi: 10.3897/jhr.87.72842 MONOGRAPH () Hymenopter a https://jhr.pensoft.net Thelnternatonl Sciey of Hymenoptariss, RESEARCH A maximalist approach to the systematics of a biological control agent: Gryon aetherium Talamas, sp. nov. (Hymenoptera, Scelionidae) Elijah J. Talamas', Jonathan S. Bremer', Matthew R. Moore', Marie-Claude Bon’, Zachary Lahey’, Cheryl G. Roberts', Lynn A. Combee', Natalie McGathey', Simon van Noort*, Alexander V. Timokhov’, Evelyne Hougardy®, Brian Hoge® | Florida Department of Agriculture and Consumer Services, Gainesville, FL, USA 2) USDA-ARS-EBCL, Montpellier, France 3 Department of Evolution, Ecology, and Organismal Biology, The Ohio State University, Columbus, OH, USA 4 Iziko South African Museum, Cape Town, South Africa § Lomonosov Moscow State University, Moscow, Russia 6 USDA-ARS-ISPH, Albany, CA, USA Corresponding author: Elijah J. Talamas (elijah.talamas@fdacs.gov) Academic editor: Gavin Broad | Received 27 August 2021 | Accepted 29 October 2021 | Published 23 December 2021 Attp://zoobank. org/E343379E-D044-47AB-A1ED-47B3FO1LF3E59 Citation: Talamas EJ, Bremer JS, Moore MR, Bon M-C, Lahey Z, Roberts CG, Combee LA, McGathey N, van Noort S, Timokhov AV, Hougardy E, Hogg B (2021) A maximalist approach to the systematics of a biological control agent: Gryon aetherium Talamas, sp. nov. (Hymenoptera, Scelionidae). In: Lahey Z, Talamas E (Eds) Advances in the Systematics of Platygastroidea III. Journal of Hymenoptera Research 87: 323-480. https://doi.org/10.3897/jhr.87.72842 Abstract A morphological and molecular analysis of Gryon Haliday (Platygastroidea, Scelionidae) was conducted to provide a taxonomic and phylogenetic context for a species under evaluation as a biological control agent of Bagrada hilaris (Burmeister) (Hemiptera, Pentatomidae). Our analysis revealed that Gryon is polyphyletic and that the biological control agent is not G. gonikopalense, a name that was tentatively applied to this species in 2019. We here describe this species as new, Gryon aetherium Talamas sp. nov., and resurrect the generic name Hadronotus Forster. Morphological characters that delimit our concepts of Gryon and Hadronotus are presented. Based on morphological characters and multilocus phylogenies, we determined that five presently valid scelionid genera belong within Gryon. In total, 15 species are trans- ferred into Gryon from these genera, 215 species are transferred from Gryon to Hadronotus, and 6 species are transferred from Gryon to Dyscritobaeus Perkins. Specimens collected during field studies in California and reevaluation of specimens determined as G. myrmecophilum in Mexico reveal that G. aetherium is adventive in North America. Keywords Gryon, taxonomy, bagrada bug Copyright Elijah J. Talamas et al. This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. 324 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) Table of contents THRE © GET STI OHI Sei asc rae cence cons eudoc vem cesyendiagcesveceysteus sets euarey utente esanevenicaniedeccarmacahees 325 Scelionich parasitoids OF BaosAd VU AIIEZ Ne vwsyeadns yearned ich tunescyadya ss iaalion tuned ois eeadyadl 326 HB UNG TU IRPSE OL Yes be -CelOM oaaiirs cain cision de tapan Migrant ncns hen di, eatin Datu cmasahicabatwtcts ssn RGR? 327 SPECIES. GLOUPS: Ao teacher towne ravine cate dphie us asinyhttcemig one onslesigt ph wrtlea ole ovis Stton wa nesiseaiensinasee 327 ne era muralist AppPEOAe ne. taeek see R ane San Peel cik oo Be hee A eit one es ore nk Se 327 Iie Uesage) en (c ag Colca lato genet SAE NRE ARMA A WEASEL RATT NEW AR ASR Ae RN RANA 328 EMSC CHOINS ears nentevtha Soartrmegte desteecpon teanrarns oees cages oot av on tectevntearsentande davexay marae eign drones 328 Multilocus phylo@eny.fsic.tAsiosscxstea tines detadsebeth oct cnetovaiden saad MR etdcavetuavalastaascibuds 329 C@Weharcode-attal ysis .ua.5 2. eethsct the stones Re eer see a ase nes Maile aks dls Maniels 330 Phylogenetic placement ot Mari zz Min COire.c.chnsdsreswrssncunteupmnctenpontiuneentcerpented 3311 Diva BORING sett cees Sig tarsseats seers cacy cease ter teetcnaw at eryen er maeee nen rose tet (ote ee saigsd oeaaanerare 332 ataxde position anid IMbOt Mat ese. cine cakes sde ants. sete evn datsot atau h esate Retip uastleteed D392 (PIVALA CTE AIAN TO GAL a ecg Pee reece ler setae oe ane eee eeates eee eee ees 332 CU AAT TIME TEAR iiccex cer casue aeens ete ceuniteyeeetioen vet dae Colbie ite dutcibededete dite bet gcenitedes 333 PRESUME Gras. Patianasdeenke Bihan eMcoaah zane iene tute pebrenes Chane aa enh Eaaoas Panesar wage pense eutealepuacaene 333 Viole cUlarSsyALEIMALICS! .. hott ao Naag mattis Gatien ate cetvedeoneibace 339 COW DareOd to. tscniescee dha xusesteaciocstpegetentastlneve nies bs slagven tuserevanobedshbedianntennattvicesiees 334 Ti ALACLCHCUSCUSGIONAN erat stein. teetteemvessme meter teeter ercee de ande titewasnieseaneds 338 1 8F2 821s peop cy am iy RR pe IEAM ORY AEP, OF i WORST ONTT A PHAR, TOE rs or 343 ESI VOPE TAN GAR ssa sath eta vaste ce nals egal anon deat oey eects onal Oye nod pce wales easel atee 344 ICS TOO Get) KACTTC ETS iE LOE MAZE yan ouNaeTa wt ees OI, pte rag Mate vs ab duarnastedane pideewes 348 ErernOSGC1 20 PUIEBSTICN, VIL. FOV eco Rin Rey Reee aoe oe ISI, ose gee nei teatenatannaheUbnaiaree 349 FLUNQALOGNOR-S LAD OSV MOV nose xtc stck asia ot a Dean hy xotnston snd tetel pin aniteltetidessceneitcetdes 350 Breviscciio-SundhoG lin, Syl z WOVs kaasca ssesutees ane aseoetqesnddea ascsuttensegede seta aseeiedas 351 BOI WAS SV TERUG Ve otucehss are cee BBWh cans Peaile GRA. wld s82) Pew dBiba da DSuchleth vaten use BNee: 352 IAIN OBIS yet won sticap. tccaneinnes vik bee dunsiaes vik ROT Rats eek ke ereswetaon ate aeneemeed Rave aittewnnes 1p 354 SPECIES OP G70 azad casa caapS ence eRe NEAR REA A Sa eAIG NIPRINT als aten cca Tubs Aaaeade 356 GV ONEACEDCPIUDT SPE NOW. brs iins sahewassnnsainseihacinsomeriead GUeatapeiteennnabesiensattnania dl Ohephboaarenys 356 IP) SSSELS GO Bie te ft Eo ye NAb asbaemrce hdc araes las peal hae econ hnd use te vatom os aaron atarax ata! 356 DAR OSIS As aa cieioss dos eete cedar rnncevtne cour ouescuvbuedauren aucun haedgeeunceucbugage renoceebeecseves 358 Pint eas ecu Cova hia UOT tear. M45. 8aa%e Maas Re cp aaa Beate tas as Beast cla pile Read delat 359 Pirie ra ISTE CIEL CATIONS sie Seteatany ban i'ss tener eeaeeaere berseete aa tadeeaager tretisbaecteuereeebatsn cy 2B) LCVENUIV EDO PUL AOS sta creer alee aes eeesen ets coset eerieeetteedtysiarteuenisovsaetecnevendcessnes 360 PL ZALONOTIS- EORSECH, STALL LOU oe lssclae bp bics Poe dlkek ag Sane To ehanee bub pbaA TE due bee ban Blieeepbaaads 398 Mi iscideceNl@tsch Ours hiv, Sy th AON a 2s bahia le bauclill wade sbasentet ve eased ules! 400 FIGATONGLO AES IOC, SY. SNOW Le teers ave pute sna Sede veh ge a eave oer whee ate eestee ae 400 Hale) CIE WO AY SVAN MVON Es 05_ eros cases is Se tateiake eva tate oot en dace trae eek enews etter 401 Uoleonaiaes WO, SVtte TOW rece bes acacia Meaaindsbztion ebe'ca cnsamela Mecatecesectieas ves dasriasved 401 odie a lotet Hic, iS vied (UO V.cisnelaney outinnit oesietay Sevreasley ee denice paley det eevee sa vieeotlTiw ouster sne'et 401 Ay strosccl@ IOOUdy SYM WON. ctcassubne+ityatevas ions aheatedicvgenyaatndianite nance hdiengnede) 401 FALL OPV ANUTUGATENCE, SYR. WOW ao bas toe reteden cde tte ro aaier te lereibncdeeucanatelsenteatt® 401 PTE TONS Bok secedsasspoensuc shks eaiulon dog ods tnbaindtanc thet mobs yatat es cdeichsnd sinh Beds hed det Bretats 401 A maximalist approach to the systematics of Gryon aetherium 325 SPeCles Olle GA ON OE kage ae ene bh oven oe SR waa Sock A es Se ral lh alee 402 Phyloceneticiplacement:ona igi ze. Tee Basieunssth oncasen tute benil eae raed ga ise abe manel 454 Generic transters to jecrtto bets Perkins secccscwets esscetiacsesesecdetoits ikatacetuckeseens 454 Relatiorisiitpssitn amy Orient.) 03.477 btn voice acheter aiistee aoc fesse inetaeteetue erates 455 IDISCU SICH Renae sme tal Suk Rel. Ae ES OEE, eee Boa Reena en 456 GOT: bar coe iit sx 2, ere eae noe es Oe Sees ee cae Ee Ae Eee 456 BhiylOcenchicss ets. Wan. /5 25 5 See 5. hone. AN a Se ee A Ba SNe 458 implications-torbiolesicalhee mn teal eit 2M Ment Samsl Mutt ahead nese nied ale 458 PNEKTIOW IEG OTVETIUES tacco db son oe teiesiedn sa a on toate sped entree eSne te cea pap ene taearee nsec eats anand ces ten tonne 461 RELQREINCONR se ssc. cov sat es sag at Sees stg EER tone oes heed hs er Stegner ec es seat goes UNE 462 Introduction Bagrada bug, Bagrada hilaris (Burmeister) (Hemiptera, Pentatomidae), is an agricultur- ally destructive pest that has invaded North and South America (Palumbo and Natwick 2010; Bundy et al. 2012; Reed et al. 2013; SAnchez-Pefia 2014; Fatindez et al. 2016; Palumbo et al. 2016). It is a pest of several brassicaceous crops and ornamental plants (Palumbo and Natwick 2010; Reed et al. 2013) and young seedlings are particularly vulnerable to feeding damage (Huang et al. 2014). Current control practices rely most- ly on conventional insecticides which lead to increased production costs and negative impacts on natural enemies and human health (Stark and Banks 2003). Initial surveys in northern and central California, where most of the nation’s brassicaceous crops are grown, found that parasitoids attacked far less than 1% of sentinel eggs that were de- ployed (B. Hogg, unpublished data). The unique oviposition behavior of B. ilaris, the only pentatomid species known to bury its eggs in the soil (Taylor et al. 2014), is a likely factor in limiting the efficacy of natural enemies in newly invaded regions. Economic consequences caused by the bagrada bug were at times severe, with 53 certified organic cole crop farms in California reporting losses of $25,000 to $100,000 from bagrada bug in 2014-2015, resulting in total annual losses of $1.3 to 5.3 million for these farms alone (California Certified Organic Farmers, personal communication). This prompted the initiation of a biological control program that imported egg parasitoids from Pakistan (Mahmood et al. 2015), the most likely ori- gin of the invasive B. hilaris population in the United States (Sforza et al. 2017), into quarantine facilities for host range testing. Two of the most promising species were egg-parasitoid wasps in the family Scelionidae: Trissolcus hyalinipennis Rajmo- hana & Narendran and a species of Gryon Haliday. The recent revision of Trissolcus Ashmead in the Palearctic region (Talamas et al. 2017a) made identification of the former a straightforward task, demonstrating the value of taxonomic preparedness as discussed by Buffington et al. (2018). Regarding taxonomic preparedness in Gryon, the North America fauna was revised by Masner (1983) but thorough and methodical treatments at the species-level are lacking for most other parts of the world. This created a challenge for identifying the Gryon species (G. aetherium Talamas) that stood out as a promising classical biocontrol 326 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) agent because of its ability to parasitize 25-55% of the eggs laid in the soil in labora- tory settings (Tofangsazi et al. 2020; Martel and Sforza 2021). This species was initially identified by the first author as Gryon gonikopalense Sharma, based on the proximity of the collecting locality of the holotype (India) to that of the biological control agent (Pa- kistan), and the apparent congruence of morphology among the specimens examined. However, G. gonikopalense was originally described from a single specimen (Figures 77-78), precluding evaluation of intraspecific variability or characters that are obscured by glue or missing from the holotype specimen (e.g., wings). Martel et al. (2019) men- tioned that the name of the biocontrol agent might change as the taxonomy of Gryon improved and alerted readers to this possibility. The name G. gonikopalense has since been used in Tofangsazi et al. (2020), Martel and Sforza (2021), Hougardy and Hogg (2021) and Martel et al. (2021). As the project progressed, the morphological similarity between species and the appearance of vast geographical ranges for some Gryon species made it clear that this identification needed to be verified with a more intensive analysis that included both molecular data and a broader examination of specimens. The former had the potential to determine if Gryon could be separated into morphologically identifiable, monophy- letic species groups and so representatives from throughout the genus were analyzed. Some characters that we found to be important for diagnosis were not used by previous workers, thus requiring a fresh examination of primary types to correctly characterize and place species. Given the species richness of Gryon, this is a laborious, ongoing task that is essential for advancing its taxonomy. It has required travel on five continents and nearly five years to make a reasonably confident statement about the identity of the parasitoid species in question. Scelionid parasitoids of Bagrada hilaris Field studies in North America reported seven species of scelionid wasps associated with bagrada bug eggs. Four species of Trissolcus were reared in southern California: Tris- solcus basalis (Wollaston), Tr. hullensis (Harrington), Tr utahensis (Ashmead), and the adventive 77. hyalinipennis (Ganjisaffar et al. 2018, 2020). In Mexico, a more diverse assemblage of scelionids was recovered from bagrada bug eggs: Idris elba Talamas, Tel- enomus podisi Ashmead, Tr. basalis, and a species of Gryon that was initially determined by the first author as G. myrmecophilum (Ashmead) (Felipe-Victoriano et al. 2019; Lo- meli-Flores et al. 2019). However, as Felipe-Victoriano et al. (2019) noted, the COI sequences of specimens reared from bagrada eggs in Mexico were highly divergent from G. myrmecophilum collected elsewhere on the continent. We here reevaluate and correct the identifications of the Gryon species under consideration as a biological control agent and the specimens reared from bagrada eggs in Mexico. ‘This is done considering multi- ple sources of evidence that include molecular and morphological analyses of specimens from a broad geographical area, comparison to primary types, evaluation of host-related variability, and crossbreeding experiments conducted by Hogg et al. (2021). A maximalist approach to the systematics of Gryon aetherium B27 A brief history of Gryon Gryon was erected by Haliday (1833), making it among the earliest genera described in Scelionidae. Two decades later, Forster (1856) described Acolus and Hadronotus in the same publication. Seven years after this, Motschoulsky (1863) described the monotypic Muscidea. Thirteen generic names that are junior synonyms of Gryon were described during the 20" century, of which 11 were described between 1908 and 1926 (Table 5). Hadronotus Forster remained a valid genus until Masner (1961) treated it as a junior synonym of Gryon, stating that the characters provided by Forster (1856) and Maneval (1940) were unreliable for separating the two genera. Gryon has since been treated as a polytypic taxon in which numerous species groups have been established to provide some level of subgeneric classification for well over 300 species. Many taxonomic treatments of Gryon have been limited in scope, whereas large- scale syntheses are needed to manage a genus of its size. This situation made it clear that major reassessments of its limits and constituent species were needed, including detailed characterization of historic type specimens. We thus prioritized the examina- tion and imaging of primary types. For species whose type material we have yet to examine, we relied on original descriptions for generic placement. ‘This process revealed that many original descriptions are woefully inadequate, and some are so brief that they can hardly be considered the result of serious taxonomic study. Unfortunately, this phenomenon is not limited to Gryon and many taxa in Platygastroidea are plagued by a casual approach to assigning names to species. Species groups One of our initial goals was to delimit species groups within Gryon to facilitate revi- sionary projects of more manageable size. This task is beyond the scope of the current treatment. However, we are confident that our phylogenetic analyses provide a signif- cant step toward a subgeneric classification and preliminary examination has revealed numerous morphological characters that warrant further study. The maximalist approach We term our approach to the systematics of G. aetherium as “maximalist” for a few reasons. First, we employed biological, morphological, and molecular species datasets in the delimi- tation of this species and experimentally assessed the effect of host species on intraspecific variation. This level of analysis is rarely conducted in the original description of species, and though likely not feasible for many taxa, it is warranted by the the economic and agri- cultural significance of G. aetherium. Second, we have simultaneously made every effort to overcome the “superficial description impediment” sensu Meier et al. (2021) to accelerate and facilitate future work on Gryon and Hadronotus. To this end, we have established new character systems that are informative at the levels of genus and species and demonstrated the utility of the molecular markers used in our phylogenies. We have made freely avail- 328 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) able all data for species that are actively under study, including images of all primary types examined (>150) and images of all Gryon and Hadronotus species that we sequenced for molecular analyses. Lastly, we use the term “maximalist” because our approach may be considered a counterpoint to the recent “minimalist revision” of Sharkey et al. (2021). Material and methods Collections Specimens on which this work is based are deposited in the following repositories with abbreviations used in the text: ANIC CASC CDFA CNCI EMEC FSCA HNHM ICIPE IEBR MCSN MFNB MNHN MZLU Australian National Collection of Insects, Canberra, Australia California Academy of Sciences, San Francisco, California, USA California Department of Food and Agriculture, Sacramento, California, USA Canadian National Collection of Insects, Ottawa, Canada Essig Museum of Entomology, Berkeley, California, USA Florida State Collection of Arthropods, Gainesville, Florida, USA Hungarian Natural History Museum, Budapest, Hungary International Centre of Insect Physiology and Ecology, Nairobi, Kenya Institute of Ecology and Biological Resources, Hanoi, Vietnam Museo Civico di Storia Naturale “Giacomo Doria’, Genoa, Italy Museum ftir Naturkunde Berlin, Berlin, Germany Muséum national d’Histoire naturelle, Paris, France Lund Museum of Zoology, Lund, Sweden NHMW Naturhistorisches Museum Wien, Vienna, Austria NHM OSUC SAMA SAMC SNU UASK UCFC UCRC USNM ZMMU Natural History Museum, London, England C.A. Triplehorn Insect Collection, The Ohio State University, Columbus, Ohio, USA South Australian Museum, Adelaide, Australian Iziko Museums of South Africa, Cape Town, South Africa College for Agriculture and Life Sciences, Seoul National University, Seoul, South Korea Ukrainian Academy of Science, Kiev, Ukraine University of Central Florida Collection of Arthropods, Orlando, Florida, USA Entomological Research Museum, University of California, Riverside, Cali- fornia, USA National Museum of Natural History, Smithsonian Institution, Washington, DC, USA Zoological Museum, Lomonosov Moscow State University, Moscow, Russia A maximalist approach to the systematics of Gryon aetherium B29) Table |. PCR primers used in this study. Primer Sequence (5’-3’) Citation 18S-H17F AAATTACCCACTCCCGGCA Heraty et al. (2004) 18S-H35R TGGTGAGGTTTCCCGTGTT 28S-D23F GAGAGTTCAAGAGTACGTG Park and Foighil (2000) 28S-b TCGGAAGGAACCAGCTACTA Whiting et al. (1997) SceWeIF-1 GTAAGTGTCACGGGATGTC Chen et al. (2021) SceWegIR-1 TTGACTTCACAGCACCAGT LCO1490 GGTCAACAAATCATAAAGATATTGG Folmer et al. (1994) HCO2198 TAAACTTCAGGGTGACCAAAAAATCA Cruaud et al. (2010) LCO1490puc TTTCAACWAATCATAAAGATATTGG HCO2198puc TAAACTTCWGGRTGWCCAAARAATCA LEP-F1 ATTCAACCAATCATAAAGATAT Hebert et al. (2004) LEP-R1 C1-J-1632 TAAACTTCTGGATGTCCAAAAA TGATCAAATTTATAAT Kambhampati and Smith (1995) C1-N-2191 CCCGGTAAAAT TAAAATATAAACTTC Simon et al. (1994) Multilocus phylogeny Extraction, amplification, and sequencing were performed at the European Biological Control Laboratory (EBCL) and the Florida State Collection of Arthropods (FSCA). Genomic DNA was nondestructively isolated from entire specimens using the Qiagen DNeasy kit (Hilden, Germany) as published in Taekul et al. (2014) with the modifica- tions specified in Sabbatini Peverieri et al. (2018). Vouchers from extractions at EBCL were shipped in absolute ethanol to FSCA for further morphological examination. All residual gDNAs are archived at EBCL and FSCA. Amplification procedures, including thermocycling conditions for COI, 18S rRNA, 28S rRNA, and Wingless, were done as described in Talamas et al. (2019) with primers provided in Table 1. Amplicon se- quencing and sequence editing were done as described in Talamas et al. (2019). PCRs targeted four loci: two nuclear ribosomal genes, 18S rRNA (variable region V3-V5) and the 28S rRNA (D2-D3 expansion regions), the nuclear gene Wingless (exon), and the mitochondrial 5’ end of the cytochrome c oxydase subunit I gene (COJ), also named the barcode region. ‘These loci were selected for their compatibility with previous datasets examining the relationships of platygastroid species across several taxonomic scales (Murphy et al. 2007; Taekul et al. 2014; Talamas et al. 2019; Chen et al. 2021). The COI barcode was predominantly amplified using the primers of Folmer et al. (1994) and Hebert et al. (2004). When these did not amplify, we used the primers of Cruaud et al. (2010), Kambhampati and Smith (1995) and Simon et al. (1994). PCRs utilized the KAPA HiFi HotStart Readymix Kit (Roche Diagnostics) per the manufacturer's protocol in 25 uL reactions (Table 2). Amplicons were purified and pre- pared for sequencing with BigDye Terminator v.3.1 chemistry (Applied Biosystems). Sequence traces were trimmed in Sequencher 5.4.6. and assembled into contigs. Newly generated sequences were submitted to GenBank and their accession number are pre- sented in Suppl. material 1 (highlighted in blue). Probaryconus Kieffer was selected as the furthest scelionid outgroup to root the phylogenetic analyses based on the topologies of Chen et al. (2021). Diverse ex- 330 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) Table 2. Thermocycle conditions. Primers Thermocycle 18S-H17F/18S-H35R 1) 98C/3 min; 35x of steps 2-4: 2) 95C/30 sec; 3) 52C/45 sec; 4) 72C/1 min; 5) 72C/10 min; 4C/ce 28S-D23F/28S-b 1) 98C/3 min; 35x of steps 2-4: 2) 95C/30 sec; 3) 57C/45 sec; 4) 72C/1 min; 5) 72C/10 min; 4C/ce SceWegIF-1/SceWegIR-1 1) 98C/3 min; 35x of steps 2-4: 2) 95C/30 sec; 3) 60C/30 sec; 4) 72C/1 min; 5) 72C/7 min; 4C/ce LCO1490/HCO2198; 1) 98C/3 min; 32x of steps 2-4: 2) 95C/30 sec; 3) 50C/30 sec; 4) 72C/45 sec; 5) 72C/7 min; 4C/oo LEP-F1/LEP-R1 LCO1490puc/ 1) 94C/3 min; 10x of steps 2-4: 2) 94C/30 sec; 3) 48C/1 min; 4) 72C/1 min ; 30x of steps 2-4: 2) HCO2198puc 94C/30 sec; 3) 5O0C/1 min; 4) 72C/1 min; 5) 72C/10 min; 4C/ce C1-J-1632/C1-N-2191 1) 95C/2 min; 30x of steps 2-4: 2) 98C/20 sec; 3) 40C/30 sec; 4) 72C/ 30 sec; 5) 72C/7 min; 4C/ce emplar scelionid ingroups were included to place Gryon specimens within the con- text of the family (Suppl. material 1). Individual loci were aligned with MAFFT v.7.394 (Katoh and Standley 2013) using either the E-INS-i (18S, 28S) or L-INS-i (COI, Wingless) algorithms. The loci were then concatenated into a supermatrix and maximum likelihood phylogenetic analyses were performed with IQ-TREE v1.6.12 (Nguyen et al. 2015). Eight partitions were originally specified for the concatenated data matrix: one partition for each ribosomal gene (18S, 28S) and one partition for each codon position of COI and Wingless. Automated model selection and parti- tion merging was performed with ModelFinder as implemented in IQ-TREE (MFP option; Kalyaanamoorthy et al. 2017), which reduced the number of partitions to seven (Table 3). We estimated branch support in our three analyses with two metrics: (1) the non-parametric bootstrap (Felsenstein 1985), (2) the ultrafast bootstrap in IQ-TREE (Hoang et al. 2018). The same concatenated supermatrix and partition file served as input in each analysis. Non-parametric bootstrap support was esti- mated from 100 bootstrap replicates and 25 independent tree runs. Ultrafast boot- strap support was estimated from 10,000 bootstrap replicates, with the -bnni flag specified to minimize potential model violations (Hoang et al. 2018a), Maximum parsimony tree searches of the concatenated multigene dataset were conducted in MPBoot (Hoang et al. 2018b) using default parsimony ratchet settings. Maximum parsimony support for nodes was assessed using 10,000 ultrafast bootstraps. The phylogenetic tree presented in Figures 1-3 text is the topology recovered from the IQ-TREE ultrafast bootstrap analysis (best tree from 10 independent runs), with UFBoot, non-parametric bootstrap, and MPBoot values indicated on the branches. COI barcode analysis The Barcode of Life Database (BOLD; Ratnasingham and Hebert 2007) was mined for additional Gryon sequences. ‘This included all sequences identified as Gryon in the database. Each barcode generated during this study was queried to the BOLD identif- cation engine. Hits that were returned with 94% or greater sequence similarity, regard- less of the identification-level, were included in further analyses. The mined sequences’ corresponding BOLD BINs (Ratnasingham and Hebert 2013) containing specimen images and metadata were then examined to further evaluate their identification as A maximalist approach to the systematics of Gryon aetherium 331 Table 3. Results of the automated model selection analysis conducted on the loci used for phylogenetic inference. Partition No. Locus Model i 18S+wel3 TN+F+R8 2 28S SYM+R5 3 coil GTR+F+R5 4 coi2 TVM+F+I+G4 5 coi3 GTR+F+R7 6 well SYM+1+G4 7 wel2 SYM+G4 Gryon (Suppl. material 5). Taxon sampling for COI analyses otherwise followed the scelionid multigene dataset scheme. Initial COI alignments revealed several indel events across Scelionidae. The COI alignment contained 479 scelionid terminals. DNA sequences were trans- lated into amino acids using the invertebrate mitochondrial translation table and aligned using the default settings of MUSCLE (Edgar 2004) as implemented in MEGAX (Kumar et al. 2018). Amino acids were back-translated to DNA for max- imum-likelihood phylogenetic analysis in IQ-TREE v2.0.5 (Minh et al. 2020) on the XSEDE computing cluster as part of the CIPRES Science Gateway (Miller et al. 2010). Model selection was performed using ModelFinder (Kalyaanamoorthy et al. 2017) with a single partition. The best-fit model according to the Bayes- ian Information Criterion was GITR+F+I+G4. Node support was calculated using 2,000 ultrafast bootstrap replicates (Hoang et al. 2018). Tree files were edited in FigTree v1.4.3 (Rambaut 2012) to aesthetically arrange nodes. Scelionid COI amino acids were manually compared to the helix-loop annotations of the elaterid beetle Agrypnus murinus (L.) (GenBank accession KJ963738.1) (Pentinsaari et al. 2016). The location (helix or loop) of amino acid deletions was recorded and scored as a COI phenotype across the dataset. Phylogenetic placement of Maruzza Mineo While screening sequences for potential contaminants and after conducting the phylogenetic analyses presented in Figures 1—4, one of us (EJT) determined a speci- men from Taiwan, originally identified as Hadronotus, to be Maruzza japonica Mi- neo (Figures 96—99) using the characters in Mineo (1982a). The only sequence data available for M. japonica was COI, which was not included in the COI phyloge- netic dataset described above based on its placement in a preliminary phylogenetic analysis that identified it as a potential contaminant. The methods for this analysis follow those of the multi-gene scelionid phylogeny, except that taxon sampling was expanded to include specimens for which only COI sequences were available. Our motivation for reporting the results of this analysis is to propose an initial phyloge- netic hypothesis for the placement of Maruzza within Platygastroidea and provide evidence that supports its status as a valid genus. 332, Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) Imaging Photographs were captured with multiple imaging systems: a Z16 Leica lens with a JVC KY-F75U digital camera using Cartograph and Automontage software; an Olympus BX51 compound microscope with a Canon EOS 70D digital SLR camera; and a Leica DM2500 compound microscope with a Leica DFC425 camera; and a Leica M165 compound micro- scope with a Leica DFC450 camera. Illumination was achieved with a lighting dome or with LED gooseneck lamps and mylar light dispersers. Images were rendered from Z-stacks with Automontage, Helicon Focus or Zerene Stacker. In some cases, multiple montage images were stitched together in Photoshop to produce larger images at high resolution and magnification. Dissections for scanning electron microscopy were performed with a minuten probe and forceps. Body parts were mounted to a 12 mm slotted aluminum mount- ing stub (EMS Cat. #75220) using a carbon adhesive tab (EMS Cat. #77825-12) and sputter coated with approximately 70 nm of gold/palladium using Cressington 108 and Denton IV sputtercoaters. Micrographs were captured using a Hitachi TM3000 Tabletop SEM and a Phenom XL G2 Desktop SEM. Data deposition and informatics Results of the phylogenetic analyses and their corresponding sequence matrices and partition files have been deposited in Dryad (https://doi.org/10.5061/dryad. dbrv15f18). The numbers prefixed with acronyms, e.g., “USNMENT” or “OSUC ”, are unique identifiers for the individual specimens (note the blank space after some acronyms). The data associated with CUIDs presented in this study are deposited at mbd-db.osu.edu (MBD). Morphological terms were matched to concepts in the Hymenoptera Anatomy Ontology (Yoder et al. 2010) using the text analyzer function. A table of morphological terms and URI links is provided in Suppl. material 4. The description of Gryon aetheriumwas generated from a matrix in the online program vSysLab (vsyslab.osu.edu) in the format of character: state. Images of many primary types were made available by the Platygastroidea Planetary Biodiversity Inventory and the photographic catalogs of ‘Talamas et al. (2017b) and Talamas and Pham (2017). For each species in which images are deposited in MBD, formerly the Hymenoptera Online Database (HOL), we provide collecting unit identi- fiers (CUIDs) that can be entered into the search form at mbd-p.asc.ohio-state.edu. For other images, we provide urls either to zenodo.org, where we have deposited additional images, or links where other collections have made these images available. In cases where colleagues have generously provided images of primary types that were uploaded by the present authors, the contributor is listed in the comment section at zenodo.org. Character annotations atc acetabular carina (Figure 62) ats postacetabular sulcus (Figure 62) axu axillula (Figures 5, 7-8, 23, 25, 27, 34, 36, 51, 87, 101, 109, 113) A maximalist approach to the systematics of Gryon aetherium 533 eps episternal foveae (Figure 64) Ipc lateral propodeal carina (Figure 65) IpS1 lateral pit on S1 (Figures 16, 18) IpT1 lateral pit on T1 (Figures 15, 23, 25, 27, 31, 34, 37, 80, 87, 104, 108, 113) mc mesopleural carina (Figures 62, 75—76, 78) mes mesopleural epicoxal sulcus (Figure 62) mtpl metapleuron (Figures 23, 25) oc occipital carina (Figure 60) ps _ papillary sensilla (Figure 39, 61, 116) s seta (Figures 9, 103, 109) sc sublateral carina on T1 (Figures 15, 104, 108) sgs subgenual spines (Figures 21, 28, 33, 38, 46, 66, 79, 111, 112, 115) spf sulcus of propodeal foramen (Figures 63, 65) T1 metasomal tergite 1 (Figure 109) vplc ventral mesopleural carina (Figure 62) Quarantine rearing To assess intraspecific variability, we examined G. aetherium that were reared from multiple pentatomid species during host specificity testing. Bagrada hilaris, Thyanta custator (Fab.), Holcostethus abbreviatus Uhler, Banasa sordida (Uhler) and Euschistus conspersus Uhler were collected in north-central California (Monterey, Alameda, Solano or Yolo counties) and maintained in laboratory cultures at the USDA-ARS in Albany, CA, under 28-30 °C, 30-— 40% RH and 16L:8D photoperiod. A laboratory colony of G. aetherium was maintained in the USDA-ARS quarantine facility in Albany, California, under 22-27 °C, 40-60% RH and 14L:10D, and host specificity tests were conducted in quarantine under the same conditions. Tests followed a no-choice design, whereby individual parasitoids were exposed to one species of pentatomid egg in glass vials. Clusters of 10-15 fresh pentatomid eggs (<24 h old) were glued onto strips of card stock (20 x 60 mm) using Elmer’s Glue-All (Elm- er’s Products Inc., Westerville, OH) and placed in glass vials (25 mm diameter x 95mm high), and one 24- to 48-hour-old, mated female parasitoid was then released into each vial and removed after 24 hours. At least one vial containing B. hilaris eggs was also exposed to parasitoids, when possible, to compare the suitability of non-target pentatomids and B. hilaris to the parasitoids. Eggs were then monitored, and numbers of parasitized eggs and emerging pentatomids and parasitoids were recorded. Unhatched eggs were then dissected after ~30 days to record numbers of parasitoid larvae that failed to complete development. Results Molecular systematics We used multiple genetic loci and extensive taxon sampling within Platygastroidea to infer the placement of Gryon aetherium. The concatenated alignment consisted of 194 334 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) taxa, 2,706 sites (base pairs and gaps), and 4.3% missing data. Eighty-one (41%) of the 194 taxa were determined as Gryon. Three independent phylogenetic analyses were performed on the alignment that differed by the type of branch support metric (ultra- fast bootstrap, non-parametric bootstrap) or tree search strategy (maximum-likelihood, parsimony) employed (Figures 1—3). In all analyses, several clades were recovered that corroborate the results of prior phylogenetic studies on Scelionidae (Taekul et al. 2014; Chen et al. 2021): (1) the basal position of Neoscelio Dodd (100% UFBS/NPBS); (2) the polyphyly of the subfamily Scelioninae; (3) the monophyly of the tribe Scelionini (65% UFBS, 33% NPBS); (4) the monophyly of Teleasinae (>95% UFBS/NPBS); and (5) the monophyly of Telenominae sensu Taekul et al. (2014) (100% UFBS/NPBS). The taxa initially determined as belonging to Gryon were recovered as a polyphy- letic assemblage composed of two clades. Clade A, with 35 taxa, forms a maximally supported (99—100% support) terminal cluster of species that is sister to a weakly sup- ported (76% UFBS, 17% NPBS) clade of spider-egg parasitoids (/dris Forster, Cera- tobaeus Ashmead) (Figure 2). We recognize the taxa in clade A as Hadronotus, which we remove from synonymy with Gryon. Clade B is composed of 51 taxa and forms a maximally supported (99-100% support) group sister to Dyscritobaeus Perkins (97% UFBS, 92% NPBS). Within this clade, the three specimens of G. aetherium sp. n. clus- tered together at maximum support (100%), as a clade basal to Gryon specimens from California (USA), Myanmar, and South Africa (Figure 3). COI barcoding Sequencing efforts generated 124 new COI barcodes. Annotation of COI amino acids demonstrated that at least four, possibly six, indel phenotypes were present in the scelio- nid dataset (Table 4, Suppl. material 2). All scelionids analyzed displayed a three amino acid deletion in loop 3, with the single exception of Platyscelidris fossorius Johnson & Musetti, which contained a two amino acid deletion in loop 3 (Table 4). The simplest phenotype (present in 43 genera) has a three amino acid deletion in loop 3 with no other detected deletions. This phenotype is present in Gryon and Maruzza (Table 4). The dataset contained eight Breviscelio Sundholm (=Gryon) barcodes, two of which spanned the entirety of the annotated Agrypnus murinus sequence. The longest two Breviscelio sequences had an additional single amino acid deletion present in loop 1 that was not de- tected in any other of the analyzed genera (Table 4). Another group of COI phenotypes contained additional amino acid deletions in loop 4. The genera Acanthoscelio Ashmead, Baryconus Forster, Gryonoides Dodd, Teleasinae gen. sp., and Trimorus Forster displayed single amino acid deletions in loop 4. Gryonoides sp. (QSUC 627839) had three amino acids deleted from loop 4, while the other two available Gryonoides COI sequences (data not shown in Suppl. material 2) contained only one deletion. A group of 13 genera, in- cluding Hadronotus, had a two amino acid deletion present in loop 4 (Table 4). COI barcoding of G. aetherium from Mexico, California, and the quarantined colony collected from Pakistan revealed two haplotypes, differing by two synonymous substitutions. One of the haplotypes is a 100% match to two specimens, previously de- A maximalist approach to the systematics of Gryon aetherium 335 OSUGa34Me Probanycomus aufigns -———— 950181541 Probanyomssp [OU 0625 Neosotiia te Hadronotus Clade A Dyscritobaeus Gryon Clade B peel cry Figure |. Best tree from the multi-gene, maximum likelihood phylogenetic analysis of Scelionidae con- ducted in IQ-TREE. Branch support values were generated from 10,000 ultrafast bootstrap replicates and are indicated above branches. ‘The positions of Hadronotus (Clade A), Gryon (Clade B), and Dyscritobaeus (Clade B) are indicated in green, blue, and red, respectively. 336 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) O0SUC534623_Idris_sp a | OSUC176054_Ceratobaeus_sp oO OSUC321852_Odontacolus_sp B OSUC420743_Idris_sp 0SUC420751_ldris_sp | a. ia FSCA 00094727 (PL335) USA: DC FSCA 00091039 (PL338) USA: FL ao M427 M430 r] an oO OSUC248210_Thailand SS Oo OSUC266778_Kenya a FSCA 00091862 (PL134) USA: CA |_| FSCA 00091871 (PL124) USA: KY | Com" Fsca 00091138 (PL329) USA: NM | FSCA 00090939 (GRYON219) USA: VA ao OSUC266775_Kenya L__ OSUC176056_USA: OH wm | FSCA 00094729 (PL336) USA: DC oO FSCA 00094729 (PL334) USA: DC DPI_FSCA 00009874 (GRYON161) USA: AL Wi’ FSCA 00090910 (GRYON217) USA: GA FSCA 00033157 (GRYON168) USA: FL USNMENT01223737 (GRYON12) USA: CA FSCA 00091193 (PL212) USA: FL USNMENT01335646 (GRYON109) USA: FL | Ml! FSCA 00033158 (GRYON169) USA: FL a OSUC176020_Paraguay OSUC266789_Bolivia Se USNMENTO01335790 (GRYON133) USA: FL Support Values | - FSCA 00033171 (GRYON165) Mexico: Baja USNMENT01335647 (GRYON106) USA: FL 95-—100% a Com '— USNMENT01335649 (GRYON108) USA: FL = FSCA 00094731 (PL332) USA: DC 70-94% ia] Hadronotus -—— FSCA 00090487 (GRYON209) USA: VA ECL Mp FSCA 00094696 (PL217) USA: AZ < 70% FSCA 00094698 (PL219) USA: AZ . - FSCA 00091124 (PL328) USA: NM | FSCA 0091864 (PL132) USA: VA Clade absent [oe mt FSCA 00091865 (PL131) USA: VA 0.05 FSCA 0094730 (PL333) USA: DC Figure 2. Position and phylogenetic relationships of Hadronotus relative to other Scelionidae based on the topology depicted in Figure 1. Colored boxes above branches correspond to the level of support ob- tained for that branch based on the support metric. Branches annotated with a single box received equal levels of support in all analyses. The scale bar indicates the expected number of substitutions per site. termined as G. myrmecophilum from Coahuila, Mexico (MK720831 and MK720832). These specimens (FSCA 00090442, FSCA 00090443) were misidentified and are G. aetherium. BOLD queries of G. aetherium barcodes yielded greater than 99% matches to 41 additional public sequences in BIN BOLD:ACF7890. The sequence hits were from Pakistan, Egypt, and South Africa and are identified as Scelioninae. Examina- tion of the three images associated with BIN BOLD:ACF7890 revealed that they are consistent with G. aetherium. These additional sequences suggest several more COI haplotypes of G. aetherium, all with about 99% sequence similarity to each other. Based on the overall sequence similarity, specimen images, and specimen locality data we consider that BIN BOLD:ACF7890 corresponds to G. aetherium, suggesting that the species has a wide distribution. The next nearest cluster of sequences to G. aetherium in BOLD are private and identified only as Platygastridae from Israel and Lebanon. Maximum-likelihood tree searches of the scelionid COI barcode dataset recovered a bootstrap consensus tree of log-likelihood -39550.451 (Figure 4). The tree topology A maximalist approach to the systematics of Gryon aetherium 337 | in M429 Dyscritobaeus_sp OSUC176007_Dyscritobaeus_sp DPI_FSCA 00009833 (GRYON 193) USA: CA _ f= USNMENT01223795 (GRYON19) USA: MD [a — FSCA 00090887 (GRYON212) South Africa FSCA 00094805 (PL332) Republic of Georgia - USNMENT01335583 (GRYON40) India USNMENT01335625 (GRYON101) South Africa USNMENT01335812 (GRYON140) Kenya = | [ME Fsca 00090543 (PL34) Myanmar FSCA 00090443 (PL30) Mexico Gryon FSCA 00033319 (PL11) USA: CA Pri a 2 COM! Fsca 00090442 (PL29) Mexico : SAM-HYM-P093668 (PL234) South Africa es |OCPe cL FSCA 00090544 (PL39) Myanmar 0.05 @ ! Fsca 00090552 (PL40) Myanmar USNMENT01223936 (GRYON13)USA: CA SAM-HYM-P093662 (PL264) South Africa | SAM-HYM-P093658 (PL267) South Africa [Er] SAM-HYM-P093675 (PL242) South Africa SAM-HYM-P093301 (PL265) South Africa SAM-HYM-P093308 (PL266) South Africa USNMENT01335824 (GRYON152) Kenya FSCA 00090886 (GRYON211) South Africa USNMENT01335826 (GRYON154) Kenya Oo USNMENT01223954 (GRYON6) USA: NM oO | SAM-HYM-P093263 (PL232) South Africa SAM-HYM-P093637 (PL235) South Africa SAM-HYM-P093661 (PL241) South Africa SAM-HYM-P093276 (PL245) South Africa SAM-HYM-P093303 (PL239) South Africa SAM-HYM-P093641 (PL236) South Africa USNMENT00979274 (GRYON26) USA: CA FSCA 00091102 (PL254) USA: CA FSCA 00091087 (PL247) USA: NM FSCA 00091096 (PL337) USA: NM FSCA 00091137 (PL252) USA: CA FSCA 00094787 (PL288) USA: VA USNMENT01335734 (GRYON124) USA: MD FSCA 00094784 (PL285) USA: VA USNMENT01223767 (GRYON18) USA: MD FSCA 00090560 (PL36) Myanmar Ultrafast | Standard] Ultrafast} [7 ij FSCA 00060445 (PL33) USAL AS Boot Boot Pars USNMENT01335823 (GRYON151) Kenya Cc gm, USNMENTO1223642 (GRYON25) USA: CA NMENT00979258 (GRYON27) USA: CA Support Values FSCA 00091024 (PL248) USA: CA O O 95-100% [i FSCA 00091007 (PL251) USA: CA 70-94% [i] a Fpg/SCA 00099220 (GRYON 171) USA: FL <70% FSCA 00000008 (GRYON188)USA: CA Clade absent [i CO FSCA 00091861 (PL135) USA: CA Col), USNMENT01335654 (GRYON107) USA: FL Ml! FSCA 00091048 (PL246) USA: FL Figure 3. Position and phylogenetic relationships of Gryon relative to other Scelionidae based on the topology depicted in Figure 1. Colored boxes above branches correspond to the level of support obtained for that branch based on the support metric. Branches annotated with a single box received equal levels of support in all analyses. The scale bar indicates the expected number of substitutions per site. 338 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) GMPBN273-18|Scelioninae|COISP|Pakistan MAMTO117-13|Scelioninae|COISP|KY840543|Pakistan MAMTOS01-13|Scelioninae|COISP|KY838139|Pakistan ah ri} 9 GMPBN261-18|Scelioninae|COIS5P|Pakistan Wy GMPBN190-18/Scelioninae|COI5P|Pakistan = LY >, GMPBNO73-18|Scelioninae|COISP|Pakistan MAMTP952-13|Scelioninae|COISP|KY 836834 [Pakistan MAMTP884-13|Scelioninae|COISP|KY841145|Pakistan aM Tone est ioni rige| ol? 1eve34463 Pakistan PL341 Gryon aetherium Pakistan Colon uy sre erin eels =? MAMTP$7 1-13|Scelioninae|COISP|KY845538|Pakistan GMPBN279-18|Scelioninae|COISP|Pakistan 0.2 1 15|Scelioninae! akistan PMNHE453-15|Scelioninae|COISP|KY83618)|Pakistan , PMNHF 118-15) Scelioninae|COISP|KY83166 1|Pakistan Gr yona etherium PMNHD6S5- 12 iSeelionnaelCOBRIKYS37219 /Pakisan MAMTP563-13]Scelioninae|COISP|KY847141|Pakistan PMNHF042-15|Scelioninae|CO sepacsen ver GMPQI991-19|Scelioninae|COISP|Pakistan ayaa Scelioninae|COISP|Pakistan GMPQC547-19|Scelioninae|COISP|Pakistan GMPOE! 094-19|Scelioninae|COISP|Pakistan GMPQI1305-19|Scelioninae|COISP|Pakistan GMPBO065-18|Scelioninae|COISP|Pakistan GMPQA989-19|Scelioninae|COISP|Pakistan GMPQE430-19|Scelioninae|COISP|Pakistan MAMTP881-13|Scelioninae|COISP) al GMEGL166-14|Scelioninae|COISPIE ypt MAMTO074-13|Scelioninae|COISP KVE 43826|Pakistan MAMTO144-13|Scelioninae|COISP|KY838252|Pakistan + 19|Scelioninae|COISP|Pakistan MPQG164-19|Scelioninae|COISP|Pakistan GMPQC234-19|Scelioninae|COISP|Pakistan GMEGL197-14|Scelioninae|COISP|Egypt GMPBN161-18|Scelioninae|COISP|Pakistan GMPQC363-19|Scelioninae|COISP|Pakistan -19|Scelioninae|COISP|Pakistan -19/Scelioninae|COISP|Pakistan celioninae|COI5P|Pakistan GMPQE1142- 19|Scelioninae|COISP|Pakistan a2 Figure 4. Phylogenetic relationships of Scelionidae based on a maximum likelihood analysis of 479 COI sequences. Branches in blue and red indicate Hadronotus and Gryon, respectively. Terminals belonging to G. aetherium are shown to the right of the phylogenetic tree. Terminals highlighted in yellow correspond to adventive G. aetherium specimens collected in Mexico and California. Scale bars indicate the expected number of substitutions per site. contains 89 nodes with strong support (>95% UFBS), with most strongly supported nodes corresponding to terminal clusters with some interesting exceptions (Figure 4). A Gryon aetherium cluster was recovered with 100% support. This terminal cluster is nested within a larger group of sequences with marginal support (92% UFBS) identi- fied as Gryon or predicted to be Gryon from our datamining procedure. The large Gryon clade was recovered as sister (with very weak support) to a strongly supported (100% UFBS) clade comprising Telenomus Haliday, Phanuromyia Dodd, Trissolcus, Gryonoides, and two Gryon. Hadronotus sequences, and those predicted to be Hadronotus from our datamining procedure, were more variably placed in the topology. One clade of Had- ronotus was recovered as sister to Fusicornia Risbec with weak support. Internal to this node, support becomes stronger (88% UFBS and 98% UFBS) (Suppl. material 3). The remaining Hadronotus fell into a weakly supported clade (54% UFBS) that included Idris, Ceratobaeus, Odontacolus Kieffer and Thoronella Masner (Suppl. material 3). Character discussion Axillula The scutellar-axillar complex is a rich source of characters that have yet to be fully ex- ploited in the taxonomy of Platygastroidea. Striation within the area delimited by the 339 A maximalist approach to the systematics of Gryon aetherium Table 4. COI amino acid phenotypes of Scelionidae. Taxa are listed and colored according to phenotype. Gryon and Hadronotus are highlighted in blue. Genus No. Helix Loop1 Helix Loop Helix Loop 3 Helix Loop 4 Helix Loop Helix Seq. 1 2 2 3 4 5 5 6 Acolomorpha 1 No No = 3 AAdeletion No No No No No Amblyscelio 1 No No 3 AAdeletion No No No No No Anteromorpha 1 No 3 AA deletion No No No No No Apteroscelio 1 No No — 3 AA deletion No No No No No Calliscelio 1 - No No No No — 3 AAdeletion No No No No No Calotelea 2 No No — 3 AA deletion No No No No No Ceratobaeus 1 No No — 3 AA deletion No No No No No Cremastobaeus 2 - No No No No — 3 AAdeletion No No No No No Dicroscelio 1 - No No No No = 3 AAdeletion No No No No No Duta 1 No 3. AA deletion No No No No No Dyscritobaeus 2 No No = 3AAdeletion No No No No No Elgonia 1 No 3 AA deletion No No No No No Embidobia 1 No 3 AA deletion No No No No No Fusicornia 1 - No No No No — 3 AA deletion No No No No No Gryon 157 No No No No No _ — 3AA deletion No No No No No Heptascelio 1 No No — 3 AAdeletion No No No No No Idris 3 No No — 3 AA deletion No No No No No Leptoteleia 1 No No 3 AAdeletion No No No No No Macroteleia 3 No No — 3 AA deletion No No No No No Mantibaria 1 No No — 3 AA deletion No No No No No Maruzza 1 — - No No No — 3 AAdeletion No No No No No Masnerella 1 No No — 3 AA deletion No No No No No Neoscelio 1 No No — 3 AA deletion No No No No No Odontacolus 1 No No — 3 AA deletion No No No No No Oreiscelio 1 No No — 3 AA deletion No No No No No Oxyscelio 1 No No = 3 AAdeletion No No No No No Oxyteleia 1 No No = 3 AAdeletion No No No No No Parascelio 1 No No — 3 AA deletion No No No No No Paratelenomus 1 No No — 3AA deletion No No No No No Platyscelio 1 No No = 3 AAdeletion No No No No No Probaryconus 2 No No 3 AAdeletion No No No No No Pseudanteris 1 No No — 3 AA deletion No No No No No Pseudoheptascelio 1 No No 3 AAdeletion No No No No No Psilanteris 3 No No — 3AA deletion No No No No No Psix 2 No No — 3 AA deletion No No No No No Romilius 2 - No No No No = 3 AAdeletion No No No No No Scelio 4 No No — 3 AA deletion No No No No No Shreemana 1 No 3. AA deletion No No No No No Spiniteleia 1 - No No No No = 3AAdeletion No No No No No Synoditella 1 No No = 3 AAdeletion No No No No No Tiphodytes 2 No No 3 AAdeletion No No No No No Trichoteleia 2 No No No No No — 3 AAdeletion No No No No No Trissoscelio 1 No No — 3 AA deletion No No No No No Triteleia 2 No No 3 AA deletion No No No No No (Gryon) Breviscelio 8 No 1AA No No No 3 AA deletion No No No No No deletion Acanthoscelio 1 No No — 3 AA deletion No 1AAdeletion No No No 340 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) Genus No. Helix Loop1 Helix Loop Helix Loop 3 Helix Loop 4 Helix Loop Helix Seq. 1 2 2 3 4 5 5 6 Baryconus 1 ~ No No No No 3 AA deletion No 1AAdeletion No No No Gryonoides 1 - No No No No = 3AAdeletion No 3AAdeletion* No No No Teleasinae gen. sp. 1 No 3 AA deletion No 1AAdeletion No No No Trimorus 1 No No 3 AA deletion No 1AAdeletion No No No Anteris 1 No 3 AA deletion No 2AAdeletion No No No Axea 1 No No 3 AA deletion No 2AAdeletion No No No Dichoteleas 1 No No 3 AA deletion No 2AAdeletion No No No Eumicrosoma 1 No No No No No 3 AA deletion No 2AAdeletion No No - Hadronotus 169 No No No No No 3 AA deletion No 2AAdeletion No No No Mallateleia 1 No 3 AA deletion No 2AAdeletion No No No Paridris 5 No No 3 AA deletion No 2AAdeletion No No No Phanuromyia 1 No No 3 AA deletion No 2AAdeletion No No No Platyscelidris 1 No No 2AAdeletion** No 2AAdeletion No No No Telenomus 43 No No No No No 3 AA deletion No 2AAdeletion No No No Thoron 2 No No 3 AA deletion No 2AAdeletion No No No Thoronella 1 No No 3 AA deletion No 2AAdeletion No No No Trissolcus 22 No No No No No 3 AA deletion No 2AAdeletion No No No *Gryonoides sp. OSUC 627839 displays a 3 AA deletion in loop 4. Other available Gryonoides barcodes contain a single AA deletion in loop 4. **Platyscelidris fossorius OSUC 165081 is the only sequence with a 2 AA deletion in loop 3. axillar, transaxillar, and axillular carinae can take a variety of forms (Figures 5—8). Fig- ure 6 illustrates this area in Duta Nixon where the foveae on the posterior and ventral portions are orthogonal to each other and the anterior portion has a series of flanges. In Gryon, the axillula is striate with the striae parallel or nearly so. ‘The striae are oblique relative to the longitudinal axis of the body and oriented from anterodorsal to poster- oventral. This is generally a reliable character for Gryon, albeit one that is sometimes obscured by the base of the forewing, and we know of two cases in which the striae are largely absent or irregular (see comments sections for G. moczari and G. paradigma). In Hadronotus, the foveae within the axillula can be ovoid or circular (Figures 7-8). Metapleuron The metapleuron in Gryon has 1—3 setae in the anterodorsal corner and occasionally a single seta in the dorsal metapleural area, but it is otherwise glabrous (Figure 9). In Hadronotus, setation is typically present in the foveae of the paracoxal sulcus, the metapleural epicoxal sulcus, and the posterior or posterodorsal portion of the sclerite (Figures 10-12). In many cases, the metapleuron is divided antero-posteriorly by a carina or a change in setation or sculpture (Figures 11-13). For example, in H. anserculus (Mineo), a line of sparse setae separates the posterior, smooth portion from the anterior, more rugose portion (Figure 13). In a few cases, such as H. canus (Mineo), the entire metapleuron is setose (Figure 14). Metasomal tergite 1 In Gryon, the line of foveae along the anterior margin of T1 terminates laterally at a carina (Figure 15, sc) that is more robust that any adjacent striation; directly A maximalist approach to the systematics of Gryon aetherium 341 Figures 5-8. Scutellar-axillar complex, lateral view 5 Gryon aetherium (USNMENT01109155) 6 Duta (USNMENT01109621_2) 7 Hadronotus hogenakalensis (DP1_FSCA 00008722) 8 Hadronotus carinati- frons (USNMENT01335649). lateral to this carina is a pit (Figure 15, lpT 1). The foveae along the anterior mar- gin are uniform in size and distinctly smaller than the lateral pit. In Hadronotus, the foveae along anterior T1 are largest at the midline and decrease in size later- ally (Figures 17, 19). In most cases, there is no suggestion of a pronounced carina or lateral pit, but in H. bicolor Ashmead, for example, the penultimate fovea on lateral T1 is larger than the fovea directly mesad (Figure 18). However, this does not approximate the form found in Gryon. The pattern along anterior S1 in Gryon aetherium is essentially identical to that on T1, with a line of uniform, small foveae terminating at a carina, then a large pit (Figure 16, lpS1). However, we do not yet draw any conclusions about S1 in Gryon because this sclerite is not easily visible in most specimens and we have dissected and analyzed a relatively small number of species. The presence of a large lateral pit on S1 is more common in Scelionidae and it appears in both Hadronotus (Figures 18, 20) and Teleasinae. Diagnostic summary 1 Clypeus not projecting ventrally; antennal scrobe with transverse sculpture; metapleuron divided dorsoventrally by a change in sculpture or setation; metapleuron usually setose in posterior portion; hind tibia without subgenual 342 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) 2 0.1mm ' = SS "'Y : O1mm | Figures 9-14. Mesosoma, lateral view 9 Gryon aetherium (FSCA 00094874) 10 Hadronotus hogenakalen- sis (DPI_FSCA 00008722) I 1 Hadronotus ater (FSCA 00094730) 12 Hadronotus pennsylvanicus (FSCA 00091081) 13 Hadronotus anserculus, holotype female 14 Hadronotus canus, holotype female. spines; foveae along anterior T'1 decreasing in size laterally, not bordered later- alliyalyysaScaiclinakGT pit. S.sts eho peste eee A ee eal Hadronotus Forster - Clypeus projecting ventrally, usually with sharp lateral corners; antennal scrobe without transverse sculpture; metapleuron undivided dorsoventrally by a change in sculpture or setation; metapleuron with 1—3 setae in anterodor- sal corner, sometimes with a single seta in dorsal metapleural area, otherwise glabrous; hind tibia with subgenual spines; foveae along anterior T1 roughly equal in size, ending in a sublateral carina or pit... Gryon Haliday A maximalist approach to the systematics of Gryon aetherium 343 Se O1mm 0.1 mms, Figures 15-20. Metasoma 15 Gryon aetherium (FSCA 00094873), dorsolateral view 16 Gryonaetherium(FSCA00094873) ventrolateral view | 7 Hadronotus bicolor(FSCA00091193), dorsolateral view | 8 Hadronotusbicolor(FSCA00091 193), lateral view | 9 Hadronotuscarinatifrons(USNMENT01335649), dorsolateral view 20 Hadronotus carinatifrons, ventrolateral view. Images Links to images of primary or secondary types are provided in the treatment for each species. Table 5 includes these links for primary types of genera and summarizes the re- arrangement of generic synonyms in Gryon and Hadronotus. Table 6 lists the specimens in the molecular analyses that have been photographed, which includes all specimens of Gryon and most Hadronotus, to further illustrate the characters associated with these 344 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) genera and some of the diversity of their constituent species. Images of Maruzza ja- ponica, also from the molecular analysis, are presented in Figures 96-99. Gryon Haliday Gryon Haliday, 1833: 271 (original description. Type species: Gryon misellum Haliday, by monotypy, keyed); Walker, 1836: 343 (description); Westwood, 1840: 77 (de- scription); Blanchard, 1840: 289 (junior synonym of Teé/eas Latreille); Brullé, 1846: 619 (description); Férster, 1856: 101, 105 (diagnosis, keyed); Marshall, 1873: 16 (catalog of species of Britain); Walker, 1874: 9 (keyed); Howard, 1886: 172 (keyed); Cresson, 1887: 84 (keyed); Ashmead, 1893: 181, 205 (description, keyed, key to species of U.S. and Canada); Dalla Torre, 1898: 502 (catalog of species); Ashmead, 1900: 327 (list of species of West Indies); Ashmead, 1903: 90 (keyed); Kieffer, 1908: 188, 189 (description, keyed); Brues, 1908: 19, 25, 49 (diagnosis, keyed, list of species); Kieffer, 1910: 91, 92 (description, list of species, keyed); Kieffer, 1912: 109 (description); Kieffer, 1913: 212 (description, taxonomic status, key to species of Europe and Algeria); Dodd, 1914a: 75 (keyed); Kieffer, 1926: 173, 260 (description, keyed, key to species); Morley, 1929: 54 (catalog of species of Britain); Dodd, 1930: 42 (keyed); Nixon, 1936: 115 (taxonomic status, position); Maneval, 1940: 112, 113 (keyed); Fouts, 1948: 92 (keyed); Muesebeck & Walkley, 1951: 356 (citation of type species); Masner, 1961: 158 (synonymy, systematic position, description); Kozlov, 1963a: 354, 357 (description, key to species of USSR, keyed); Kozlov, 1963b: 661, 667 (description, keyed, key to species); Szabé, 1966: 422 (keyed); De Santis, 1967: 225 (catalog of species of Argentina); Safavi, 1968: 418 (parasitized eggs of Scutelleridae keyed); Hellén, 1971: 5, 21 (description, keyed); Kozlov, 1971: 38 (keyed); Kozlov, 1972: 654 (key to new species described); Alayo Dalmau, 1973: 99 (catalog of species of Cuba); Simons, Reardon & Ticehurst, 1974: 15 (keyed); Viggiani & Mineo, 1974: 160, 161 (keyed); Mani & Mukerjee, 1976: 497 (key to new species described); Masner, 1976: 7, 57 (description, synon- ymy, keyed); Fergusson, 1978: 118 (checklist of species of Britain); Kozlov, 1978: 619 (description, key to species of European USSR); Mineo, 1979b: 91 (diagno- sis, key to species parasitizing Aelia and Eurygaster (Hemiptera: Pentatomidae)); Muesebeck, 1979: 1157 (catalog of species of U.S. and Canada); Masner, 1980: 12, 13 (keyed); Mineo, 1980b: 216 (diagnoses and keys to species of insulare and pu- bescens species groups); De Santis, 1980: 311 (catalog of species of Brazil); Mineo, 1981a: 119 (description and key to species of the muscaeformis species group); Mani & Sharma, 1982: 152, 191 (description, keyed); Mineo & Villa, 1982b: 175 (taxo- nomic value of pleural structures, clypeus, and antennal sensilla); Mineo & Villa, 1982a: 134 (taxonomic value of structures on the posterior surface of the head); Sharma, 1982: 336 (key to species of India); Masner, 1983: 126, 127 (description, morphology, division into species groups, key to species of North America, keyed); Mineo, 1983b: 285 (description and key to species of the pubescens species group); A maximalist approach to the systematics of Gryon aetherium 345 Table 5. A summary of the genera treated as junior synonyms of Gryon and Hadronotus with links to available images of primary types. Genus Date Type species Images of Type Specimen Gryon Haliday 1833 Gryon misellum Haliday https://zenodo.org/record/4498847#.YBrybXlOlaQ Acolus Forster 1856 Acolus opacus Thomson Plastogryon Kieffer 1908 Plastogryon foersteri Kieffer Psilacolus Kieffer 1908 Acolus xanthogaster Ashmead USNMENT00989056 Holacolus Kieffer 1912 Acolus opacus Thomson Plesiobaeus Kieffer 1913 Plesiobaeus hospes Kieffer Hadronotellus Kieffer 1917 — Hadronotellus pedester Kieffer ZMUC 0002 Heterogryon Kieffer 1926 Plastogryon sagax Kieffer Synteleia Fouts 1927 Synteleia coracina Fouts USNMENT00989057 Evemioscelio Priesner 1951 — Eremioscelio cydnoides Priesner USNMENT01059665 Hungarogryon Szabé 1966 Hungarogryon moczari Szabé Hym.Typ.No. 9634, Mus.Budapest Masneria Szab6 1966 Hadronotus lymantriae Masner Pannongryon Szabé 1966 Pannongryon szelenyii Szabé https://zenodo.org/record/4521320#.YCGzRn|OlaQ Sundholmia Szabé 1966 Sundholmia nitens Szab6 Breviscelio Sundholm 1970 — Breviscelio crenatus Sundholm __ https://www.flickr.com/photos/127240649@N08/50616991701/ in/photolist-2k7 Rjat-2k7 Mx3 Y-2k7 Rj9 M-2k7RTii-2k7Rja8/ Exon Masner 1980 Exon californicum Masner Hadronotus Forster 1856 Hadronotus exculptus Forster https://zenodo.org/record/4504407#.YCGDd31OlaQ. Muscidea 1863 Muscidea pubescens Motschoulsky https://zenodo.org/record/4924954#.YOSoF0I/KhaQ. Motschoulsky Hadronotoides Dodd 1913 — Hadronotus pentatomus Dodd SAMA DB 32-001664 Platyteleia Dodd 1913 Platyteleia latipennis Dodd SAMA 1.1396 Telenomoides Dodd —- 1913 Telenomoides flavipes Dodd https://zenodo.org/record/5188097#.YRUi0OMpKhaQ. Notilena Bréthes 1913 Notilena gallardoi Bréthes Austroscelio Dodd 1914 Sparasion nigricoxa Dodd SAMA DB 32-001667 Hadrophanurus 1926 Telenomus pennsylvanicus https://zenodo.org/record/4520251#.YCGBzXlOlaQ Kieffer Ashmead Mineo, 1983c: 546, 551 (descriptions and keys to species of the insulare and ocu- latum species groups); Mineo, 1983a: 12 (description and key to species of the charon species group); Galloway & Austin, 1984: 6, 78 (diagnosis, synonymy, list of species described from Australia, keyed); Mineo & Caleca, 1987b: 41 (diagnoses of the misellum, artum, austrafricanum and hospes species groups; key to species of the artum group); Kozlov & Kononova, 1989: 78 (key to species of the USSR); Kozlov & Kononova, 1990: 96, 265, 266 (description, division into species groups, key to species of Palearctic, keyed); Caleca, 1990a: 116 (description, key to species of pentatomum group); Mineo, 1990a: 171, 174, 180, 182 (description of artum, muscaeforme, myrmecophilum, oculatum, pubescens groups); Mineo, 1990b: 49, 52 (description of hiberus, leptocorisae species groups); Mineo, 1990c: 90 (description of /etus group, key to species of /etus group); Mineo, 1991: 1, 2, 7, 9, 10, 12 (de- scription of aculum, acuteangulatum, aureum, cydnoide, hungaricum, introversum species groups, synonymy, key to species of /ungaricum group); Johnson, 1992: 374 (cataloged, catalog of world species); Mineo & Caleca, 1994: 114, 116, 121, 127 (designation of hirsuticolum group, fulviventre subgroup of muscaeforme group, subfasciatum group, lymantriae group, key to species of lymantriae group); Kon- onova, 1995: 62, 81 (keyed, diagnosis, key to species of Russian Far East); Austin 346 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) Table 6. List of specimens from the molecular analysis that have been photographed. It includes all specimens of Gryon and representatives for each species of Hadronotus. Taxon Gryon sp. Gryon myrmecophilum Gryon sp. Gryon crenatum Hadronotus sp. Hadronotus obesus Hadronotus sp. Hadronotus pennsylvanicus Hadronotus sp. CUID USNMENT01335610 USNMENT01335583 SAM-HYM-P093661 SAM-HYM-P093276 USNMENT01335734 USNMENT01335823 USNMENT01335654 USNMENT01335597 USNMENT01223867 USNMENT01223767 USNMENT01223642 USNMENT00979274 USNMENT00979258 SAM-HYM-P093315 SAM-HYM-P093303 FSCA 00094787 FSCA 00094784 FSCA 00091861 FSCA 00091137 FSCA 00091102 FSCA 00091067 FSCA 00091048 FSCA 00091024 FSCA 00090560 FSCA 00090445 FSCA 00033220 FSCA 00000032 FSCA 00000008 USNMENT01335826 USNMENT01335596 USNMENT01223954 SAM-HYM-P093637 SAM-HYM-P093263 FSCA 00090886 USNMENT01335595 SAM-HYM-P093641 USNMENT01335824 FSCA 00033267 USNMENT01335812 USNMENT01335625 FSCA 00090543 USNMENT01223795 USNMENT01223656 FSCA 00090887 DPI_FSCA 00009833 SAM-HYM-P093675 SAM-HYM-P093658 SAM-HYM-P093308 FSCA 00094689 SAM-HYM-P093286A DPI_FSCA 00009874 SAM-HYM-P093613 FSCA 00033171 FSCA 00094681 Link to images https://zenodo.org/record/4558207#.YN974ElKhaQ. https://zenodo.org/record/4558210#.YN98DkIKhaQ https://zenodo.org/record/4558205#.YN9I8NEIKhaQ_ https://zenodo.org/record/4558203#.YN98PU]KhaQ https://zenodo.org/record/4558198#.YN98W01KhaQ: https://zenodo.org/record/4558187#.YN98eU]KhaQ https://zenodo.org/record/4558181#.YN98jUlKhaQ https://zenodo.org/record/4558177#.YN98n01KhaQ https://zenodo.org/record/4558173#.YN98sUIKhaQ. https://zenodo.org/record/4558165#.YN98xUIKhaQ https://zenodo.org/record/4558159#.YN985ElKhaQ. https://zenodo.org/record/4558153#.YN98-ElKhaQ https://zenodo.org/record/4558145#.YNIIDEIKhaQ. https://zenodo.org/record/4558143#.YN99IkIKhaQ https://zenodo.org/record/4558141#.YNIINOIKhaQ https://zenodo.org/record/4558138#.YN99SkIKhaQ https://zenodo.org/record/4558120#.YN99ce01KhaQ https://zenodo.org/record/4558116#.YN99jklIKhaQ https://zenodo.org/record/4558108#.YN99zUIKhaQ https://zenodo.org/record/4558101#.YN996EIKhaQ https://zenodo.org/record/4558093#.YN9-A0IKhaQ https://zenodo.org/record/4558089#.YN9-FOlKhaQ https://zenodo.org/record/4558084#.YN9-bUIKhaQ. https://zenodo.org/record/4558078#.YN9-dElKhaQ https://zenodo.org/record/4558072#.YN9-fElKhaQ_ https://zenodo.org/record/4558056#.YN9-VEIKhaQ. https://zenodo.org/record/455805 1#.YN9-hklKhaQ https://zenodo.org/record/4558039#.YN9-mEIKhaQ https://zenodo.org/record/4558015#.YN9-rElKhaQ https://zenodo.org/record/4558011#.YN9-wklKhaQ https://zenodo.org/record/4557989#.YN9-1U]KhaQ. https://zenodo.org/record/4557969#.YN9-501KhaQ https://zenodo.org/record/4557961#.YN9_DUIKhaQ https://zenodo.org/record/4557955#.YN9_HO0|KhaQ https://zenodo.org/record/4557944#.YN9_PElKhaQ https://zenodo.org/record/4557938#.YN9_UklKhaQ https://zenodo.org/record/4557928#.YN9_ZU]KhaQ. https://zenodo.org/record/45579 17#.YN9_eElKhaQ. https://zenodo.org/record/4557913#.YN9_mUIKhaQ https://zenodo.org/record/4557902#.YN9_t0lKhaQ https://zenodo.org/record/4557899#.YN9_yklKhaQ https://zenodo.org/record/4557892#.YN9_301KhaQ https://zenodo.org/record/4557832#.YN-AxUIKhaQ https://zenodo.org/record/4557820#.YN-A101KhaQ https://zenodo.org/record/4557799#.YN-A4UIKhaQ. https://zenodo.org/record/4557773#.YN-A9UIKhaQ. https://zenodo.org/record/4557739#.YN-BWUIKhaQ https://zenodo.org/record/4557727#.YN-BaklKhaQ https://zenodo.org/record/5055893#.YORbJjOSmM8 https://zenodo.org/record/5055622#.YORbezOSmM8 https://zenodo.org/record/5055577#.YORbqTOSmM8 https://zenodo.org/record/5055533#.YORb2TOSmM8 https://zenodo.org/record/5055465#.YORb_DOSmM8 https://zenodo.org/record/5047752#.YORcIzOSmM8 A maximalist approach to the systematics of Gryon aetherium 347 Taxon CUID Link to images Hadronotus radicularis FSCA 00091862 https://zenodo.org/record/5047719#.YORcCQzOSmM8 Hadronotus sp. FSCA 00094687 https://zenodo.org/record/5080975#.YOYIWOhKg2w FSCA 00094692 https://zenodo.org/record/5080835#.YOYKsOhKg2w Hadronotus pennsylvanicus FSCA 00094782 https://zenodo.org/record/5081043#.YOYODOhKg2w Hadronotus sp. SAM-HYM-P093638 _ https://zenodo.org/record/5086004#. YOhpzzOSmM8 USNMENT01223737 https://zenodo.org/record/5085986#.YOhqNTOSmM8 SAM-HYM-P093243 _ https://zenodo.org/record/5086109#.YOhrgTOSmM8 SAM-HYM-P093622 _https://zenodo.org/record/5086454#. YOh3-ElKhaQ SAM-HYM-P093679 _https://zenodo.org/record/5086600#. YOh6JEIKhaQ Hadronotus anasae USNMENT01335790 _ https://zenodo.org/record/5093270#. YOyFIklKhaQ Hadronotus atrum FSCA 00094730 https://zenodo.org/record/5093412#.YOyFEUIKhaQ. Hadronotus carinatifrons USNMENT01335649 _ https://zenodo.org/record/5093598#.YOyE8UIKhaQ Hadronotus bicolor FSCA 00091193 https://zenodo.org/record/5093580#.YOyFAUIKhaQ Hadronotus leptocorisae FSCA 00090459 hetps://zenodo.org/record/5093611#.YOyE3UIKhaQ. Hadronotus rugiceps FSCA 00094731 https://zenodo.org/record/5093642#.YOyH_OlKhaQ & Field, 1997: 36, 68 (structure of ovipositor system, discussion of phylogenetic relationships); Lé, 2000: 32, 95 (keyed, description, key to species of Vietnam); Kononova & Petrov, 2001: 1468 (description); Kononova & Petrov, 2002: 53 (key to species of Palearctic); Loiacono & Margaria, 2002: 557 (catalog of Brazilian spe- cies); Rajmohana K., 2006: 115, 123 (description, keyed); Fabritius & Popovici, 2007: 11, 13, 14, 26, 29, 63 (description, key to Romanian species, key to species related to Gryon longiabdominalis and buhli, keyed); Kononova & Kozlov, 2008: 25, 321, 322 (description, keyed, key to species of Palearctic region); Popovici & Johnson, 2012: 382 (description of internal genitalia); Rajmohana, 2014: 8, 33 (description, keyed); Talamas & Buffington, 2015: 21 (fossil in Dominican amber). Comments. The lectotype and paralectotype specimens of G. misellum Haliday are in excellent condition considering their age (~ 190 years old) and these specimens dis- play all the diagnostic characters that we associate with the genus (Figures 21—25). Acolus Forster, 1856: 100, 102 (original description. Type species: Acolus opacus Thomson, designated by Ashmead (1903), keyed. Synonymized by Masner (1961)); Thomson, 1859: 417, 422 (description, keyed); Walker, 1874: 9 (keyed); Howard, 1886: 172 (keyed); Cresson, 1887: 83, 313 (keyed, catalog of species of U.S. and Canada); Ashmead, 1893: 167, 168, 174 (description, keyed); Dalla Torre, 1898: 510 (catalog of species); Ashmead, 1903: 88, 89 (keyed); Kieffer, 1908: 179, 180 (description, key to species, keyed); Brues, 1908: 14, 15, 16, 47 (diagnosis, keyed, list of species); Kieffer, 1910: 100, 101 (description, list of species, keyed); Kieffer, 1912: 89, 92 (description, key to species of Europe and Algeria); Kieffer, 1912: 55 (key to species of Seychelles); Dodd, 1914a: 58, 70 (key to species of Australia, keyed); Brues, 1916: 542 (keyed); Kieffer, 1926: 133, 156 (description, keyed, key to species); Jansson, 1939: 173 (keyed); Maneval, 1940: 111 (keyed); Muesebeck & Walkley, 1956: 324 (citation of type species); Masner, 1961: 158 (junior synonym of Gryon Haliday). Plastogryon Kieffer, 1908: 119, 141 (original description. Type: Plastogryon foer- steri Kieffer, designated by Brues (1908)); Brues, 1908: 51 (diagnosis, list of species, type designation); Kieffer, 1910: 65, 81 (description, list of species, 348 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) keyed); Dodd, 1913a: 131 (keyed); Kieffer, 1913: 230, 245 (description, key to species of Europe and Algeria); Dodd, 1915: 24 (key to species of Australia); Dodd, 1915: 24 (key to species of Australia); Kieffer, 1926: 270, 446 (descrip- tion, keyed, key to subgenera, key to species); Jansson, 1939: 172 (keyed); Muesebeck & Walkley, 1956: 385 (citation of type species); Masner 1961: 158 (junior synonym of Gryon Haliday). Psilacolus Kieffer, 1908: 179, 180 (original description. Type species: Acolus xanthogaster Ashmead, designated by Kieffer (1926)); Brues, 1908: 47 (diagnosis, list of spe- cies); Kieffer, 1910: 100, 101 (description, list of species, keyed); Kieffer, 1912: 88 (description); Dodd, 1914a: 59 (keyed); Kieffer, 1926: 132, 151 (description, keyed, key to species); Muesebeck & Walkley, 1956: 393 (citation of type species); Muesebeck & Masner, 1967: 299 (junior synonym of Gryon Haliday). Holacolus Kieffer, 1912: 89, 106 (original description. Type species: Acolus opacus Thom- son, designated by Muesebeck & Walkley (1956). Key to species of Europe and Algeria); Kieffer, 1926: 133, 169 (description, keyed, key to species); Jansson, 1939: 173 (keyed); Maneval, 1940: 111 (keyed); Muesebeck & Walkley, 1956: 359 (des- ignation of type species); Masner, 1961: 158 (junior synonym of Gryon Haliday). Plesiobaeus Kieffer syn. rev., 1913: 229, 282 (original description. Type: Plesiobaeus hospes Kieffer, by monotypy); Kieffer, 1926: 271, 556 (description, keyed); Morley, 1929: 54 (catalog of species of Britain); Jansson, 1939: 172 (keyed); Maneval, 1940: 112 (keyed); Muesebeck & Walkley, 1956: 386 (citation of type species); Szabé, 1966: 422 (keyed); Kozlov, 1971: 38 (keyed); Fergusson, 1978: 118 (checklist of species of Britain); Kozlov, 1978: 621 (description); Mineo, 1979a: 248 (junior synonym of Gryon Haliday); Masner, 1980: 13 (keyed); Kozlov & Kononova, 1990: 96, 265, 307 (description, keyed); Fabritius & Popovici, 2007: 11, 34, 63 (description, keyed); Kononova & Kozlov, 2008: 25, 445 (description, keyed, treated as valid genus). Comments. Mineo (1979a) stated that Plesiobaeus hospes seemed to be conspecific with Gryon misellum based on its original description. He also stated that the type was examined but did not provide characters based on this examination to support the generic transfer. Mineo and Caleca (1987b) reported that the species in this group, containing only G. hospes, had a 1-2-2-0 claval formula, which is consistent with some species of Gryon, e.g., G. moczari, whereas no species of Hadronotus known to us has such a claval formula. Hadronotellus Kieffer, 1917: 341 (original description. Type: Hadronotellus pedester Kieffer, by monotypy and original designation. Synonymized by Kieffer (1926)); Muesebeck & Walkley, 1956: 357 (citation of type species); Szabé, 1966: 421, 422 (description, key to Palearctic species known to the author, keyed); Hellén, 1971: 5, 22 (description, keyed). Heterogryon Kieffer, 1926: 271, 446, 448 (original description. Type: Plastogryon sagax Kieffer, designated by Muesebeck & Walkley (1956). Proposed as a subgenus of Plastogryon, keyed. Synonymized by Masner (1961)); Muesebeck & Walkley, 1956: 359 (designation of type species); Masner, 1961: 158 (junior synonym of Gryon Haliday). A maximalist approach to the systematics of Gryon aetherium 349 Figure 21. Gryon misellum, lectotype male (NMINH_2018_11_02), dorsal view. Eremioscelio Priesner syn. rev., 1951: 129 (original description. Type: Evemioscelio cyd- noides Priesner, by monotypy and original designation); Muesebeck & Walkley, 1956: 351 (citation of type species); Kozlov, 1963a: 354, 357 (description, keyed); Kozlov, 1963b: 661, 666 (description, keyed); Kozlov, 1971: 38, 49 (synonymy, keyed); Kozlov, 1972: 656 (key to species); Masner, 1976: 59 (description); Ko- zlov, 1978: 621 (description, key to species of European USSR); Kozlov & Konon- ova, 1990: 95, 265, 310, 311 (description, key to species of USSR, keyed); Mineo, 1991: 1, 9 (junior synonym of Gryon Haliday, described as cydnoide species group); Johnson, 1992: 372 (cataloged, catalog of world species); Kononova, 1995: 62, 85 350 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) 0.1,.mm “a J <= = = | 26 | 4 - | l ‘ 0.2 mm 28 | — =e ie Figures 26-28. Gryon paradigma (CNC664037) 26 head, anterior view 27 mesosoma and T1, dorso- lateral view 28 hind leg, lateral view. & Villa, 1982a: 138 (taxonomic value of structures on the posterior surface of the head); Caleca, 1990b: 139 (description); Johnson, 1992: 354 (cataloged, catalog of world species); Caleca, 1992: 52, 53 (key to species, discussion of relationships); Austin & Field, 1997: 39, 68 (structure of ovipositor system, discussion of phylo- genetic relationships). Comments. Our treatment of Breviscelio as a junior synonym of Gryon is supported by molecular and morphological evidence. Specimens of Gryon crenatum (=Breviscelio crenatus, the type species of Breviscelio) were retrieved within the Gryon clade in the 4-gene and COI analyses. The striate axillula and the lateral pit on T1 are visible in the holotype specimen (Figure 41). Figures 42—46 illustrate other specimens of Gryon crenatum from South Africa, showing that this species also has the suite of characters used to diagnose Gryon: antennal scrobe without transverse sculpture (Figure 42); head and dorsal mesosoma covered with microsculpture (Figures 42— 44); metapleuron mostly glabrous and undivided by change in sculpture or setation (Figure 43), subgenual spines present on the hind tibia (Figure 46). The conspicuous frontal ridge in G. crenatum is associated with an elongation and oblique orienta- tion of the mandibles. This association is known from other platygastroids, includ- ing Encyrtoscelio Dodd, Tyrannoscelio Masner, Johnson & Arias-Penna, Acanthoscelio (Scelionidae) and Sparasion Latreille (Sparasionidae) (Figures 47-50) and may be an adaptation for using the mandibles to dig through soil. Gryon crenatum has spines throughout the tibiae and tarsi on all legs and unusual spatulate setae found on the fore tarsus (Figure 45), which may also be adaptations for fossorial behavior. Exon Masner syn. rev., 1980: 12, 22 (original description. Type: Exon californicum Mas- ner, by original designation, keyed. Synonymized by Mineo (1980b)); Mineo, 1980b: 215 (junior synonym of Gryon Haliday); Kozlov & Kononova, 1990: 95, 265, 308 (description, key to species of USSR, keyed); Kononova & Petrov, 2002: 57 (descrip- tion, key to species of Palearctic); Fabritius & Popovici, 2007: 11, 41, 63 (descrip- tion, keyed); Kononova & Kozlov, 2008: 25, 446 (treated as valid genus, description, keyed, key to species of Palearctic region). A maximalist approach to the systematics of Gryon aetherium eae) Figures 29-34. Gryon cydnoide 29 holotype female (USNMENT01059665), head and mesosoma, an- terior view 30 female (OSUC 395743) head, anterior view 31 holotype female (USNMENT01059665), habitus, dorsal view 32 female (OSUC 395739), habitus, dorsolateral view 33 holotype female, habitus, lateral view 34 mesosoma and T1, dorsolateral view. Comments. Like Eremioscelio, Exon has moved in and out of Gryon since it was first de- scribed. Our examination of a paratype specimen indicates that it belongs in Gryon. The antennal scrobe lacks transverse sculpture, the metapleuron is mostly glabrous and undivided, and striation of the axillula is visible (Figures 51-52). Figure 53 il- lustrates the dorsal metasoma. ‘The quality of the image does not enable us to see the lateral pit on T1, but the uniform size of the foveae along the anterior margin of T1 is apparent, and this supports its placement in Gryon. 354 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) 50 um Figure 35-40. Gryon moczari 35 female (CNC664036), head, anterior view 36 holotype female, head and mesosoma, lateral view 37 female (CNC664036), head and mesosoma, dorsolateral view 38 fe- male (CNC664036), metasoma, dorsal view 39 female (CNC664036), antennal clava, ventrolateral view 40 female (CNC664036), wings, dorsal view. Diagnosis. Head with coriaceous microsculpture throughout; mandibles usually biden- tate with teeth large and roughly equal in size, sometimes tridentate with medial tooth the smallest; clypeus projecting, typically with pointed corners; ventral frons sometimes with weakly indicated facial striae; central keel present or absent; antennal scrobe convex to concave, without transverse rugae or striation, never delimited by carinae; female antenna with ten flagellomeres (nine in G. paradigma) and four clavomeres (three in G. moczari); mesoscutum and mesoscutellum with coriaceous microsculpture throughout, occasion- A maximalist approach to the systematics of Gryon aetherium D> Figures 41-46. Gryon crenatum 41 holotype female (MZLU Type no. 911:1), habitus, dorsolateral view 42 female (SAM-HYM-P093658), head, anterior view 43 female (SAM-HYM-P093675), head and mesosoma, lateral view 44 female (SAM-HYM-P093658), head, lateral view 45 female (SAM-HYM- P093658), fore tarsus, lateral view 46 female (SAM-HYM-P093658), subgenual spines on hind tibia, posterolateral view. ally with longitudinal striation or microsculpture in the form of transverse waves; epo- mial carina absent or weakly developed; netrion absent; mesoscutal suprahumeral sulcus absent; mesoscutal humeral sulcus absent or indicated by a smooth furrow; mesoscutum without humeral pit (sensu Chen et al., 2020); axillula obliquely striate; metapleuron with 1—3 setae in anterodorsal corner, sometimes with a single seta in dorsal metapleural area, otherwise glabrous; metapleuron undivided dorsoventrally by a change in sculpture 356 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) 0.5 mm y, | 0.5 mm Figures 47-50. 47 Encyrtoscelio (OSUC 334153), head, lateral view 48 Tyrannoscelio genieri Masner & Johnson (OSUC 545772), head and mesosoma, lateral view 49 Acanthoscelio (OSUC 232241), head, anterior view 50 Sparasion philippinensis (USNMENT00872835), head, anterior view. or setation; hind tibia with one or two pairs of subgenual spines; foveae along anterior T1 roughly equal in size, ending in a sublateral carina followed by a lateral pit. The two most unusual species, as far as diagnostic characters are concerned, are G. moczari and G. paradigma. The former is discussed in the comments section for the synonymy of Hungarogryon. Gryon paradigma is unusual in that the females have eleven antennomeres instead of twelve, the ventrolateral corners of the clypeus are not pointed, and the axillular striae are wavy and irregular (Figures 26-28). This species otherwise complies with the diagnosis above and we consider it to be a derived species of Gryon. Species of Gryon Gryon aetherium Talamas, sp. nov. http://zoobank.org/75100840-5BF 1-4FEC-9B53-880F0E221074 Figures 5, 9, 15-16, 54-72. Description. Color of body: dark brown to black. Color of legs: coxae and femora brown; trochanters, tibiae and tarsi yellow to pale brown. A maximalist approach to the systematics of Gryon aetherium 357 a Figures 51-53. Gryon californicum, paratype female (USNMENT01109308) 51 habitus, lateral view 52 head, anterior view 53 metasoma, dorsal view. Color of antenna in female: yellow to pale brown, A9—A12 generally darker than preceding antennomeres. Head: Number of mandibular teeth: 2. Shape of mandibular teeth: large, teeth roughly equal in size. Shape of clypeus: projecting ventrally, apex flat to convex, with sharp lateral corners. Number of clypeal setae: 6. Epiclypeal carina: absent. Facial striae: present as lines of microsculpture. Central keel: present. Line of setae above interan- tennal process: absent. Malar striae: present as lines of microsculpture. Genal carina: absent. Hyperoccipital carina: absent. Anterior margin of occipital carina on gena: smooth. Occipital carina: present dorsally and in ventral portion of gena, absent or weakened posterodorsal to compound eye. Mesosoma: Epomial carina: absent. Sculpture of lateral pronotum: reticulate mi- crosculpture. Netrion sulcus: absent. Mesoscutal suprahumeral sulcus: absent. Mesos- cutal humeral sulcus: absent. Sculpture of mesoscutum: reticulate microsculpture. Sculpture of mesoscutellar disc: reticulate microsculpture. Posterior mesoscutellar sul- cus: foveate. Posterior margin of mesoscutellum: extending over metanotum, metascutel- lum not visible in dorsal view. Posterior margin of metascutellum: slightly convex. Sculp- ture on posteroventral surface metascutellum: weakly rugulose. Sculpture of metanotal trough: foveate. Length of postmarginal vein in fore wing: about 1.5 times as long as stigmal vein. Length of marginal vein in fore wing: about half as long as stigmal vein. 358 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) Wing color: hyaline with transverse band of infuscation posterior to marginal vein. Shape of submarginal vein: straight in basal 4/5, with dip proximal to reaching wing margin. Lateral propodeal carina: continuous across posterior propodeum, forming flange around metasomal depression. Sculpture of metasomal depression: weakly rugulose. Sulcus of the propodeal foramen: foveate dorsally, absent ventrally. Cells or foveae along ventral margin of mesopleural carina: absent. Posterior limit of acetabulum: acetabular carina in- tersecting with ventral mesopleural carina. Postacetabular sulcus: foveate. Mesopleural epi- coxal sulcus: foveate. Episternal foveae: present. Mesopleural carina: absent; present only at ventral apex of femoral depression. Sculpture of anteroventral mesopleuron: reticulate mi- crosculpture. Sculpture of femoral depression: smooth. Prespecular sulcus: foveate. Sculp- ture of speculum: finely striate. Shape of subalar pit: circular. Mesepimeral sulcus: com- prised of transverse foveae, foveae absent or reduced in size posterior to speculum. Sculpture of posterior mesepimeral area: smooth. Paracoxal sulcus: indicated by transverse foveae, extending below metapleural pit but not to ventral margin of metapleuron. Metapleural epicoxal sulcus: indicated by crenulae or indistinguishable from rugose sculpture. Meta- pleural structure: not divided into anterior and posterior areas. Sculpture of dorsal meta- pleural area: transversely striate. Sculpture of ventral metapleural area: irregularly rugose. Metasoma: Macrosculpture of T1: longitudinally striate, smooth along posterior margin. Setation of T1: present lateral and posterior to lateral pit of T1. Setation of T2-T5: dense in lateral part of tergite, absent medially except for a transverse line of sparse setae along posterior margin. Posterior margin of T6: concave. Sculpture of T2— T4: finely reticulate with a smooth band along posterior margin. Sculpture of S2: finely reticulate. Setation of laterotergites: present. Transverse sulcus on anterior S2: present as a line of small foveae. Etymology. The species epithet “aetherium” derives from Latin, meaning of the sky or heavens, and refers to the unexpected appearance of this species in North America, far from its native range. Diagnosis. Gryon aetherium is best separated from other Gryon species by the fol- lowing characters: mesopleural carina entirely absent or present only at ventral apex of mesopleuron; posterior margin of mesoscutellum protruding posteriorly, concealing metascutellum and metanotal trough in dorsal view; mesopleuron with two episternal foveae; foveae of mesepimeral sulcus attenuating in size dorsally, foveae small or unde- fined posterior to speculum; acetabular carina and ventral mesopleural carina intersect- ing ventrally; metapleuron not transversely striate throughout; fore wing with infusca- tion posterior to marginal vein; hind tibia with four subgenual spines; lateral propodeal carina horizontal, extending laterally to metapleural carina. In North America, Gryon aetherium is most similar to G. myrmecophilum, from which it is most easily separated by the mesopleural carina: complete in G. myrmecophilum, ex- tending from the posteroventral apex of the femoral depression to the anterior margin of the mesopleuron; absent or present only at ventral apex of mesopleuron in G. aetherium. This character also serves well to separate G. aetherium from G. gonikopalense (Figures 77-78) G. fasciatum (73-76), and G. oligomerum Kononova, which are Old World spe- cies that are very similar to G. aetherium but have a complete mesopleural carina. A maximalist approach to the systematics of Gryon aetherium oD) Miya iin “_ 0.2mm asd : .~ , : “1 Figures 54-57. Gryon aetherium 54 holotype female (USNMENT01335778), head, anterior view 55 female (FSCA 00090468), wings, dorsal view 56 holotype female (USNMENT01335778), head, mesosoma, metasoma, lateral view 57 holotype female (USNMENT01335778), head, mesosoma, meta- soma, dorsolateral view. Intraspecific variation. Non-target testing of G. aetherium in quarantine enabled us to examine how different hosts affect the phenotype of the parasitoids. Overall, we found very little variation between specimens of G. aetherium reared from Bagrada hilaris, Thy- anta custator, Holcostethus, Banasa sordida and Euschistus conspersus (Figures 67, 69-72). The sculpture of the dorsal metapleural area varies from transversely striate to irregularly rugose. The foveae that comprise the mesepimeral sulcus decrease in size dorsally, and posterior to the speculum these foveae can be small and circular or poorly defined. Only one male specimen emerged from eggs of Banasa sordida (Figure 71), which was unusual in that the femoral depression was faintly microsculptured and the foveae of the paracoxal sulcus were shallow and not well-defined. This specimen also had malformed antennae, suggesting that Banasa sordida is not a suitable host for G. aetherium. Prior misidentifications. Gryon aetherium was misidentified twice by the first au- thor: as G. gonikopalense in Martel et al. (2019) and this name was subsequently used in Martel and Sforza (2021), Tofangsazi et al. (2020) and Hougardy and Hogg (2021), and as G. myrmecophilum in Felipe-Victoriano et al. (2019). The morphological limits of G. aetherium were unclear at the time that these names were used, resulting in a hesitancy to describe it as a new species, especially because not all relevant types had been examined. 360 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) Figures 58. Gryon aetherium, female (USNMENT01109155), habitus, ventrolateral view. Adventive populations. As implied by the previous paragraph, G. aetherium has been present in Mexico since at least June of 2018 and the study by Felipe-Victoriano et al. (2019) is thus the first record of this species in North America. It appears that G. aetherium has been in the United States for a similar length of time given that specimens were recovered from two locations in California: Davis, Yolo County, in 2020, and Mon- terey County, in 2018 and 2019. In both cases the specimens were reared from B. hilaris sentinel egg masses. A specimen from the 2018 collection (FSCA 00033319:PL11) was sequenced to confirm its identity (Figure 4). It differed from the quarantine popula- tions by three base pairs, alleviating concerns that it represented escapees. The speci- mens collected in Monterey were stored in isopropanol, which affected the color of the specimens (Figure 68) and degraded the DNA. We were not able to amplify COI from the specimens collected in Monterey, but our morphological analysis using scanning electron microscopy finds them to be identical to the specimens in quarantine and those that were retrieved in Yolo County. In 2021, a population of G. aetherium was recovered in Chile, reared from the eggs of B. hilaris (Rojas-Galvez et al. 2021). Material examined. Holotype, female: Pakistan: Punjab, Toba Tek Singh, Dabanwala leg. R. Mahmood, coll. 5—9.IV.2016, ex. eggs Bagrada hilaris 11-V-2016 on mustard, intro- duced to quarantine for EBCL colony, PP8, USNMENT01335778 (deposited in USNM). Paratypes (72 females, 37 males): MExIco: 9 females, 3 males, FSCA 000900442—00090443, 000900446-00090447, 000900468-00090475 (FSCA). Pakistan: 19 females, 8 males, FSCA 00033215-00091216, 00091221, 00094940-00094944, 00094984—-00094992; USNMENT00989933, 01109043, 01109046-01109047, 01109049, 01109052, 01109054—01109155, 01335774, 01335776 (USNM). Unrrep States: 44 females, 26 males, FSCA 00033319, 00090933, 00091210, 00091217,00091930, 00094869, 00094871, 00094873—-00094874, 00094877, 00094885, 00094899, 00094901- 00094903, 00094945— 00094981, 00094983, 00094993-00095009 (FSCA). A maximalist approach to the systematics of Gryon aetherium 361 SS SAN 2 | Figures 59-66. Gryon aetherium 59 female (FSCA 00094873), head, anterior view 60 female (FSCA 00094869), head, posterolateral view 61 female (FSCA 00094873), antennal clava, lateral view 62 female (FSCA 00094869), mesosoma, ventral view 63 female (FSCA 00094873), mesosoma, dorsolateral view 64 female (FSCA 00094874), mesosoma, anterolateral view 65 female (FSCA 00094874), mesosoma, posterolateral view 66 female (FSCA 00094871), hind tibia, dorsal view. Gryon africanum Mineo Holotype images: https://zenodo.org/record/4498963#.YBsDc3lOlaQ Gryon africanum Mineo, 1991: 19 (original description, assigned to myrmecophilum species group). 362 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) Figures 67-72. Gryon aetherium, \ateral habitus 67 female (FSCA 00094902), ex. Bagrada hilaris 68 female (FSCA 00094885), ex. Bagrada hilaris 69 female (FSCA 00094903), ex. Holcostethus 10 female (FSCA 00094899), ex. Thyanta custator T1\ male (FSCA 00094877), ex. Banasa sordida 712 male (FSCA 00094901), ex. Euschistus conspersus. Gryon amphiboli Mineo Paratype images: https://zenodo.org/record/4924883#.YMJ6RHpKhaQ Gryon amphiboli Mineo, 1991: 19 (original description, assigned to myrmecophilum species group). A maximalist approach to the systematics of Gryon aetherium 363 Comments. This species remains in Gryon based on its assignment to the myrmecophi- lum species group. Gryon amplum (Dodd) Hadronotus amplus Dodd, 1914b: 81 (original description); Dodd, 1915: 20 (keyed); Kieffer, 1926: 455, 471 (description, keyed). Mirotelenomus amplus (Dodd): Dodd, 1926: 313 (generic transfer); Galloway, 1976: 96 (type information); Johnson, 1992: 439 (cataloged, type information). Gryon amplum (Dodd): Caleca & Mineo, 1995: 19 (generic transfer). Comments. The original description states “Head and thorax very finely reticulate ru- gulose” which is consistent with placement in Gryon if it is referring to microsculpture. However, it also states “club 6-jointed”, which suggests Hadronotus. Because it is pres- ently unclear where this species belongs, we leave it in its current placement. Gryon angustipenne (Dodd) Holotype images: https://zenodo.org/record/472 1639#.YIcPhPIKhaQ Telenomoides angustipennis Dodd, 1913a: 169, 171 (original description, keyed). Hadronotus angustipennis (Dodd): Dodd, 1914a: 129 (generic transfer); Dodd, 1915: 20 (keyed); Kieffer, 1926: 456, 471 (description, keyed). Mirotelenomus angustipennis (Dodd): Dodd, 1926: 313 (generic transfer); Galloway, 1976: 96 (type information); Johnson, 1992: 439 (cataloged, type information). Gryon angustipenne (Dodd): Caleca & Mineo, 1995: 19 (generic transfer). Comments. The holotype specimen has a 4-merous clava, the carina adjacent to the lateral pit on T1 is clearly visible, and the striation inside the axillar crescent is visible in the image of the right side. These characters, combined with the lack of macrosculpture on the head and dorsal mesosoma, enable us to confidently place this species in Gryon. Gryon anna Kozlov & Kononova Gryon anna Kozlov & Kononova, 1989: 80, 96 (original description, keyed); Kozlov & Kononova, 1990: 268, 298 (description); Johnson, 1992: 379 (cataloged, type in- formation); Kononova, 1995: 85 (keyed); Kononova & Petrov, 2002: 56 (keyed); Kononova & Kozlov, 2008: 332, 428 (description, keyed); Timokhov, 2019b: 47 (catalog of species of Russia). 364 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) Comments. Two characters from the original description suggest that this species be- longs in Gryon: “Frontal depression not shallow, streaked with very fine arcuate wrin- kles. The head is fine-grained.” and Figure 1—5 illustrates a 4-merous clava. Gryon arabicum (Caleca), comb. nov. Breviscelio arabicus Caleca, 1990b: 140 (original description); Caleca, 1992: 52, 53 (type information, keyed). Gryon ariantum Kozlov & Kononova Gryon ariantum Kozlov & Kononova, 2004: 196 (original description); Kononova & Kozlov, 2008: 329, 402 (description, keyed). Comments. We leave this species in Gryon until the type specimen can be examined directly. Figure 3—6 in Kozlov and Kononova (2004) illustrates a 4-merous clava, but the original description is otherwise not informative. Gryon artum (Kozlov) comb. rev. Mirotelenomus artus Kozlov, 1963a: 356 (english translation of original description, keyed); Kozlov, 1963b: 664 (original description, keyed); Szab6, 1966: 440 (de- scription); Kozlov, 1978: 621 (description). Exon artus (Kozlov): Masner, 1980: 22 (generic transfer); Kozlov & Kononova, 1990: 309 (description, keyed); Kononova & Petrov, 2002: 57 (keyed); Fabritius & Pop- ovici, 2007: 41 (description). Gryon artus (Kozlov): Mineo, 1980a: 200 (generic transfer). Gryon artum (Kozlov): Mineo & Caleca, 1987b: 49 (emendation, keyed); Johnson, 1992: 379 (cataloged, type information); Mineo & Caleca, 1994: 122 (distribution). Exonartum(Kozlov):Kononova& Kozlov,2008:447,449 (description, keyed, generictransfer); Timokhov, 2019a: 15 (distribution); Timokhov, 201 9b: 47 (catalog of species of Russia). Comments. Kozlov (1963a) presented some characters that indicate that this species belongs in Gryon: mandibles bidentate, “Head, surface of thorax... with delicate alveolatesculpturing”. Figures 9—9 and 9-15 in this description illustrate reduced wing venation that is noteworthy. Gryon austrafricanum Mineo Gryon austrafricanum Mineo, 1979a: 236 (original description); Mineo & Caleca, 1987b: 47 (description of male); Mineo, 1990: 47 (distribution); Johnson, 1992: 379 (cataloged, type information). A maximalist approach to the systematics of Gryon aetherium 365 Comments. The original description is largely inadequate for generic placement, but it states that the mandibles are bidentate, which is consistent with this as a species of Gryon. Gryon brevipenne (Harrington) Figures 113—116; Holotype images in MBD: CNC No. 2523 Hadronotus brevipennis Harrington, 1900: 188 (original description); Brues, 1910: 47 (keyed); Kieffer, 1926: 454, 465 (description, keyed). Gryon brevipennis (Harrington): Muesebeck & Masner, 1967: 299 (generic transfer); Sarazin, 1986: 973 (type information). Gryon brevipenne (Harrington): Masner, 1983: 135, 166 (description, emenda- tion, lectotype designation, keyed); Johnson, 1992: 380 (cataloged, type in- formation). Gryon brevium Kononova Holotype images: https://zenodo.org/record/5159819#.YQqOm0RKhaQ. Gryon brevior Kononova, 2005: 1358 (original description); Kononova, Pavlicek & Nevo, 2005: 816 (description). Gryon brevius Kononova: Kononova & Kozlov, 2008: 328, 394 (description, keyed). Comments. This species remains in Gryon based on images of the holotype specimen that illustrate the striate axillula, glabrous metapleuron, and subgenual spines on the hind tibia. Gryon californicum (Masner), comb. rev. Figures 51-53; Paratype images in MBD: USNMENT01109308 Exon californicum Masner, 1980: 22 (original description). Gryon californicum (Masner): Mineo & Caleca, 1987b: 49, 50 (generic transfer, keyed); Johnson, 1992: 380 (cataloged, type information). Gryon callidum Kozlov & Kononova Holotype images: https://zenodo.org/record/5599890#.YXgJM_nMJaQ. Paratype images: https://zenodo.org/record/5599902#.YXgKb_nMJaQ. Gryon callidum Kozlov & Kononova, 2004: 197 (original description); Kononova & Kozlov, 2008: 332, 430 (description, keyed); Timokhov, 2019b: 47 (catalog of species of Russia). 366 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) Gryon caudatum Kozlov & Kononova Gryon caudatum Kozlov & Kononova, 2004: 197 (original description); Kononova & Kozlov, 2008: 326, 373 (description, keyed). Comments. This species remains in Gryon based on the abstract of Kozlov and Kon- onova (2004) which states that it is close to G. simile, Figure 2—7 in that publication, which illustrates a frontal depression without transverse sculpture, and Figure 3-7, which illustrates a 4-merous clava. Gryon chrysolaum (Walker) Telenomus chrysolaus Walker, 1839: 80 (original description). Hadronotus chrysolaus (Walker): Dodd, 1920a: 352 (generic transfer). Liophanurus chrysolaus (Walker): Kieffer, 1926: 66, 84 (description, generic transfer, keyed). Gryon chrysolaus (Walker): Masner, 1965: 75 (type information, generic transfer). Gryon chrysolaum (Walker): Johnson, 1992: 381 (cataloged, type information). Comments. The genus cannot be determined from the original description and exami- nation of the primary type is required. Gryon conicum Kozlov & Kononova Gryon conicus Kozlov & Kononova, 1989: 79, 89 (original description, keyed); Kozlov & Kononova, 1990: 267, 282 (description, keyed); Kononova & Petrov, 2002: 55 (keyed). Gryon conicum Kozlov & Kononova: Johnson, 1992: 381 (cataloged, type information); Kononova & Kozlov, 2008: 327, 381 (description, keyed); Timokhov, 2019b: 47 (catalog of species of Russia). Comments. This species remains in Gryon, largely because we cannot reliably deter- mine its genus without examination of the type specimen. Our translation of the origi- nal description is as follows. “Frontal impression superficial, with very thin arcuate wrinkles. The head is fine-grained.” This is congruent with Gryon if the arcuate wrin- kles refer to lines of microsculpture. Gryon consocium Mineo Holotype images: https://zenodo.org/record/4499111#.YBsiUHIOlaQ A maximalist approach to the systematics of Gryon aetherium 367 Gryon consocium Mineo, 1991: 20 (original description, assigned to myrmecophilum species group); Mineo & Caleca, 1994: 119 (distribution). Gryon coracinum (Fouts) Holotype images in MBD: USNMENT00989057 Synteleia coracina Fouts, 1927: 178 (original description). Gryon coracinus (Fouts): Muesebeck & Masner, 1967: 299 (generic transfer); Masner & Muesebeck, 1968: 34 (type information). Gryon coracinum (Fouts): Masner, 1983: 135, 172 (description, emendation, keyed); Johnson, 1992: 381 (cataloged, type information). Gryon cornutum Kononova & Petrov Gryon cornutus Kononova & Petrov, 2001: 1471 (original description); Kononova & Petrov, 2002: 53 (keyed). Gryon cornutum Kononova & Petrov: Kononova & Kozlov, 2008: 323, 349 (descrip- tion, keyed). Comments. This species remains in Gryon, albeit without great confidence, based on the original description: “Fine-grained head sculpture. The forehead has a well-defined frontal depression. The latter has a longitudinal carina, shin- ing, with strongly smoothed grain.” Figure 1—5 illustrates a female antenna with four clavomeres. Gryon crassifemoratum Mineo Gryon crassifemoratum Mineo, 1990a: 181 (original description. Misspelled crasife- maratum in description, abstract; correct spelling (G. Mineo) in title); Johnson, 1992: 381 (cataloged, type information). Comments. The original description for this species is woefully insufh- cient. We leave it in Gryon based on its placement in the myrmecophilum species group (Mineo 1990). Gryon crenatum (Sundholm). comb. nov. Figures 41-46; Holotype images: https://www.flickr.com/photos/127240649@ N08/50616991701/in/photolist-2k7 Rjat-2k7 Mx3 Y-2k7 Rj9M-2k7RTii-2k7Rja8/ 368 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) Breviscelio crenatus Sundholm, 1970: 383 (original description); Caleca, 1990b: 141 (description); Johnson, 1992: 355 (cataloged, type information); Caleca, 1992: 51, 53 (description, keyed). Gryon cultratum (Kozlov), comb. nov. Holotype images: https://zenodo.org/record/5600151#.YXgSFvnMJaQ Eremioscelio cultratus Kozlov, 1971: 49 (original description); Kozlov, 1972: 656 (keyed); Kozlov, 1978: 622 (description); Kozlov & Kononova, 1990: 311, 312 (description, keyed); Johnson, 1992: 373 (cataloged, type information); Kononova & Kozlov, 2008: 451, 453 (treated as valid species, description, keyed, generic transfer); Timokhov, 2019b: 47 (catalog of species of Russia). Comments. This synonymy of Evemioscelio with Gryon implicitly transfers this spe- cies. The transfer of Gryon cultratus Masner to Hadronotus means that homonomy is avoided. Gryon cydnoide (Priesner), comb. rev. Figures 29-34; Holotype images in MBD: USNMENT01059665 Hadronotus bernardi Maneval, 1940: (original description); Mineo, 1991: 9 (name considered to be unavailable). Eremioscelio cydnoides Priesner, 1951: 130 (original description); Kozlov, 1963a: 357 (de- scription); Kozlov, 1963b: 666 (description); Kozlov, 1971: 49 (description); Kozlov, 1972: 656 (keyed); Kozlov, 1978: 62 (description); Mineo & Villa, 1982b: 134 (taxo- nomic value of structures on the posterior surface of the head); Mineo & Villa, 1982a: 175 (taxonomic value of pleural structures, clypeus, and antennal sensilla); Kozlov & Kononova, 1990: 311 (description, keyed); Johnson, 1992: 373 (cataloged); Notton, 2006: 195 (distribution); Fabritius & Popovici, 2007: 36, 39 (description, keyed); Kononova & Kozlov, 2008: 451, 452 (description, keyed, generic transfer). Eremioscelio bernardi (Maneval): Masner, 1976: 59 (generic transfer, description); Mi- neo, 1991: 9 (junior synonym of Gryon cydnoide (Priesner)); Johnson, 1992: 373 (cataloged, type information). Gryon cydnoide (Priesner): Mineo, 1991: 9 (generic transfer, synonymy); Mineo & Caleca, 1994: 126 (distribution); Timokhov, 2019a: 14 (distribution); Timokhoyv, 2019b: 47 (catalog of species of Russia). Gryon delucchii Mineo & Szabé Holotype images: https://zenodo.org/record/4499 129#.YBsIZHIOlaQ A maximalist approach to the systematics of Gryon aetherium 369 Gryon delucchii Mineo & Szabé, 1978a: 88 (original description); Mineo & Gatto, 1981: 187 (description of preimaginal stages); Johnson, 1992: 381 (cataloged, type information); Kononova & Kozlov, 2008: 331, 425 (description, keyed). Gryon dicaeum (Walker) Telenomus dicaeus Walker, 1839: 80 (original description). Microphanurus dicaeus (Walker): Kieffer, 1926: 93, 109 (description, generic transfer, keyed). Gryon dicaeus (Walker): Masner, 1965: 75 (type information, generic transfer). Gryon dicaeum (Walker): Johnson, 1992: 381 (cataloged, type information). Comments. We are unable to determine from the original description if this species belongs in Hadronotus or Gryon and leave its generic placement unchanged until ex- amination of the type specimen occurs. Gryon dichropterum Kozlov Holotype images: https://zenodo.org/record/5600169#.YXgSzfnMJaQ Gryon dichropterus Kozlov, 1966: 144 (original description); Mineo, 1980a: 191 (de- scription of male); Johnson, 1992: 382 (cataloged, type information). Eremioscelio dichropterus (Kozlov): Kozlov, 1972: 657 (generic transfer, keyed); Ko- zlov, 1978: 622 (description); Kozlov & Kononova, 1990: 311, 318 (description, keyed); Kononova & Kozlov, 2008: 452, 458 (description, keyed, generic transfer); Timokhov, 2019b: 47 (catalog of species of Russia). Gryon dichropterum Kozlov: Mineo & Caleca, 1994: 127, 128 (distribution, keyed). Gryon dispar Kononova & Petrov Gryon dispar Kononova & Petrov, 2001: 1479 (original description); Kononova & Petrov, 2002: 57 (keyed); Kononova & Kozlov, 2008: 333, 436 (description, keyed). Comments. We were not able to determine from the original description if this species belongs in Gryon or Hadronotus. Its placement thus remains unchanged. Gryon elatior Masner Holotype images in MBD: CNC No. 17019 370 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) Gryon elatior Masner, 1983: 135, 173 (original description, keyed); Sarazin, 1986: 974 (type information); Johnson, 1992: 382 (cataloged, type information). Gryon elongatum Mineo, comb. rev. Holotype images: https://zenodo.org/record/4508091#.YPcj00|KhaQ Gryon elongatum Mineo, 1991: 22 (original description, assigned to myrmecophilum species group); Mineo & Caleca, 1994: 119 (distribution). Gryon mineoi Ozdikmen: Ozdikmen, 2011: 772 (replacement name for Gryon elonga- tum Mineo). Comments. The transfer of Hadronotus elongatus Risbec back to Hadronotus makes the replacement name no longer necessary for this species. Gryon eremiogryon Mineo Gryoneremiogryon Mineo, 1979a:241 (original description); Mineo, 1979b: 96 (keyed); John- son, 1992: 382 (cataloged); Kononova & Kozlov, 2008: 333, 440 (description, keyed). Comments. The original description stated that G. eremiogryon has bidentate man- dibles and the subsequent discussion expressed Mineo’s idea that G. eremiogryon was intermediate between Gryon and Eremioscelio. Given that the latter is now treated as a junior synonym of Gryon, we are fairly confident that this species belongs in Gryon. Gryon excertum Kononova & Fursov Gryon excertus Kononova & Fursov, 2005a: 595 (original description); Kononova & Fursov, 2005b: 304 (description). Gryon excertum Kononova & Fursov: Kononova & Kozlov, 2008: 329, 409 (description, keyed). Comments. The original and subsequent descriptions suggest the species should re- main in Gryon, but it is not entirely clear: “The head sculpture is fine-meshed. Head with short, dense hairs arranged horizontally. The frontal depression above the anten- nae and the longitudinal frontal carina are absent. Fan-shaped wrinkles on cheeks.” Gryon fasciatum (Priesner) Figures 73—76; Holotype images in MBD: USNMENT01059667; Images of paratype: https://zenodo.org/record/4837467#. YLExBPIKhaQ A maximalist approach to the systematics of Gryon aetherium erie Hadronotus fasciatus Priesner, 1951: 130 (original description); Mineo, 1980b: 214 (type information). Gryon fasciatus (Priesner): Kozlov, 1978: 619 (description, generic transfer); Kozlov & Kononova, 1989: 81 (keyed); Kozlov & Kononova, 1990: 269, 303 (description, keyed); Kononova & Petrov, 2002: 56 (keyed); Pintureau & al-Nabhan, 2003: 5 (new distribution record from France and Middle East (Syria)); Fabritius & Popo- vici, 2007: 15, 29 (description, keyed). Gryon fasciatum (Priesner): Mineo, 1991: 23 (description, assigned to myrmecophilum species group); Johnson, 1992: 382 (cataloged, type information); Kononova & Kozlov, 2008: 332, 434 (description, keyed); Timokhov, 2019a: 15 (distribution); Timokhov, 2019b: 47 (catalog of species of Russia). Gryon firmum Mineo Holotype images: https://zenodo.org/record/4504446#. YBxseXlOlaQ Gryon firmum Mineo, 1991: 26 (original description, assigned to myrmecophilum spe- cies group). Gryon flaviventre Kononova Gryon flaviventris Kononova, 2001: 1469 (original description); Kononova & Petrov, 2002: 53 (keyed); Fabritius & Popovici, 2007: 14, 17 (description, keyed). Gryon flaviventre Kononova: Kononova & Kozlov, 2008: 323, 345 (description, keyed); Timokhov, 2019b: 47 (catalog of species of Russia). Comments. This species remains in Gryon based on the original descrip- tion, “The head sculpture is grainy. The frontal depression is weakly expressed, its sculpture is slightly smoothed” and Figure 1—2, which illustrates a female antenna with four clavomeres. Gryon flavum (Dodd) Hadronotus flavus Dodd, 1913b: 172 (original description); Dodd, 1915: 18 (keyed); Kieffer, 1926: 455, 469 (description, keyed). Gryon flavus (Dodd): Galloway, 1976: 91 (type information, generic transfer). Gryon flavum (Dodd): Johnson, 1992: 383 (cataloged, type information). Comments. The original description is insufficient for generic placement. We leave this species in Gryon and note that the holotype female needs to be examined. 372 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) Pas. “y x ne Figures 73-76. Gryon fasciatum 73 holotype female (USNMENT01059667), habitus, dorsolateral view 74 paratype female (USNMENT01109130), habitus, lateral view 75 paratype female (USNMENT01109130), head and mesosoma ventral view 76 paratype female (USNMENT01109130), mesosoma, posterolateral view. Gryon fumosum (Dodd) Holotype images: https://zenodo.org/record/4504553#.YBxvLHIOlaQ Hadronotus fumosus Dodd, 1914a: 130 (original description); Dodd, 1915: 20 (keyed); Kieffer, 1926: 455, 472 (description, keyed). Mirotelenomus fumosus (Dodd): Dodd, 1926: 313 (generic transfer); Galloway, 1976: 109 (type information). Gryon fumosus (Dodd): Galloway & Austin, 1984: 79 (generic transfer). Gryon fumosum (Dodd): Mineo, 1990a: 180 (emendation, systematic position); John- son, 1992: 383 (cataloged, type information). Gryon fuscum Kononova Gryon fuscus Kononova, 2001: 1477 (original description); Kononova & Petrov, 2002: 55 (keyed); Fabritius 8& Popovici, 2007: 29, 68 (keyed). A maximalist approach to the systematics of Gryon aetherium 373 Gryon rutilator Kononova: Kononova & Kozlov, 2008: 328, 391 (replacement name, description, keyed); Timokhov, 2019b: 48 (catalog of species of Russia). Comments. The original description lists a few characters that indicate that this species belongs in Gryon, “The head sculpture is fine-grained. Frontal depression not shiny, with strongly smoothed grain.” Plastogryon fuscus Dodd is now treated as a junior syno- nym of Hadronotus flavipes. The replacement name, Gryon rutilator Kononova, is thus no longer needed for this species. Gryon gloriosum Kozlov & Kononova Gryon gloriosum Kozlov & Kononova, 2004: 200 (original description); Kononova & Kozlov, 2008: 332, 425 (description, keyed). Comments. We consider it most likely that this species belongs in Gryon based on the comparisons to G. hungaricum and G. laetum in the abstract of the original de- scription. Gryon goethei (Girault) Hadronotus goethei Girault, 1932: 5 (original description); Galloway, 1976: 111 (type information, status uncertain); Gordh, Menke, Dahms & Hall, 1979: 297 (reprint of Girault (1932)); Johnson, 1992: 510 (cataloged, type information). Comments. The description of this species is insufficient for generic placement and examination of the holotype specimen is required. Gryon gonikopalense Sharma Figures 77-78; Holotype images in MBD: USNMENT01109129 Gryon gonikopalensis Sharma, 1982: 327, 336 (original description, keyed). Gryon gonikopalense Sharma: Johnson, 1992: 384 (cataloged). Gryon gorines Kozlov & Lé Holotype images in MBD: IEBR 0177 Gryon gorines Kozlov & Lé, 1992: 210, 212, 221 (original description, assigned to misellum species group, keyed). 374 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) Gryon gorinis Kozlov & Lé, 1996: 10 (description); Lé, 2000: 97, 116 (description, keyed, type information). Gryon grande Kononova & Petrov Gryon grandis Kononova & Petrov, 2001: 1476 (original description); Kononova & Petrov, 2002: 55 (keyed). Gryon grande Kononova & Petrov: Kononova & Kozlov, 2008: 327, 388 (description, keyed). Comments. This species remains in Gryon based on the original description, “Head sculpture fine-grained. Frontal depression shallow, not wide, shining, with distinct lon- gitudinal carina. Frons up to anterior ocellus with fine-grained sculpture” and Figure 2-3 which illustrates a 4-merous clava. Gryon grownum Kozlov & Lé Holotype images in MBD: IEBR 0166 Gryon grownum Kozlov & Lé, 1992: 212, 221 (original description, assigned to misel- lum species group, keyed). Gryon grownus Kozlov & Lé, 1996: 10 (description); Lé, 2000: 97, 117 (description, keyed, type information). Gryon gryonis Mineo Figures 79-82; Holotype images: https://zenodo.org/record/4504698#. YBx5HX1OlaR Gryon gryonis Mineo, 1990a: 172 (original description); Johnson, 1992: 384 (cata- loged, type information). Comments. The holotype specimen is very small, only about 0.7 mm in length, and is light in color. This makes it challenging to illustrate and interpret characters with brightfield photography. We believe that this species should remain in Gryon based on the apparently 4-merous clava, absence of transverse sculpture in the frontal de- pression, the glabrous metapleuron that is not dorsoventrally divided by sculpture or setation, and the presence of subgenual spines on the hind tibia (Figures 79-82). The lateral pit on T1 appears to be present but is difficult to discern. The shape of the clypeus and the presence of striation inside the axillar crescent could not be reliably determined from the images of the anterior head and lateral mesosoma, respectively (Figures 79, 81). A maximalist approach to the systematics of Gryon aetherium 375 A : is ite ' : E 0.2mm K 0.1mm a = _ Figures 77-78. Gryon gonikopalense, holotype female (USNMENT01109129) 77 habitus, lateral view 78 mesosoma, lateral view. Figures 79-82. Gryon gryonis, holotype female 79 habitus, lateral view 80 mesosoma and T1, lateral view 81 head, anterior view 82 head and mesosoma, anterolateral view. Gryon hospes Kiefter Plesiobaeus Hospes Kieffer, 1913: 283 (original description). 376 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) Plesiobaeus hospes Kieffer: Kieffer, 1926: 556 (description); Masner, 1965: 89 (type information); Kozlov, 1978: 621 (description); Kozlov & Konono- va, 1990: 307 (description); Fabritius & Popovici, 2007: 34 (description); Kononova & Kozloy, 2008: 445 (description). Gryon hospes (Kieffer): Mineo, 1979: 248 (description, generic transfer); Mineo & Caleca, 1987: 53 (description); Johnson, 1992: 384 (cataloged, type informa- tion). Gryon howardi (Mokrzecki & Ogloblin) Hadronotus howardi Mokrzecki & Ogloblin, 1931: 1 (original description); Masner, 1958: 42 (keyed); Loiacono & Diaz, 1996: 9 (type information). Hadronotellus howardi (Mokrzecki & Ogloblin): Szabd, 1966: 422, 424 (description of male and female, generic transfer, keyed). Gryon howardi (Mokrzecki & Ogloblin): Kozlov, 1978: 620 (description, generic transfer); Mineo, 1980a: 193 (description); Kozlov & Kononova, 1989: 78 (keyed); Kozlov & Kononova, 1990: 266, 271 (description, keyed); John- son, 1992: 384 (cataloged, type information); Mineo & Caleca, 1994: 121 (distribution, assigned to subfasciatum group); Kononova & Petrov, 2002: 54 (keyed); Fabritius & Popovici, 2007: 15, 22 (description, keyed); Kononova & Kozlov, 2008: 325, 366 (description, keyed); Timokhov, 2019b: 47 (catalog of species of Russia). Comments. Figure 3 of the original description clearly illustrates the presence of sub- genual spines, confirming that this species belongs in Gryon. Gryon hungaricum (Szabo) Holotype images: https://zenodo.org/record/4505223#.YByRRXI1OlaQ, https://zeno- do.org/record/5600192#.YX¢gTu_nMJaQ Pannongryon hungaricum Szab6, 1966: 435, 436 (original description, keyed). Gryon prolongatus Kozlov, 1971: 48 (original description. Synonymized by Mineo (1980a)); Kozlov, 1978: 620 (description); Mineo, 1980a: 196 (junior synonym of Gryon hungaricum (Szab6)); Kozlov & Kononova, 1989: 79 (keyed); Kozlov & Kononova, 1990: 267, 287 (description, keyed); Kononova & Petrov, 2002: 53 (keyed); Fabritius & Popovici, 2007: 14, 20 (description, keyed). Gryon hungaricum (Szabo): Mineo, 1980a: 196 (generic transfer, synonymy); Mineo, 1991: 10, 12 (description, assigned to hungaricum species group, keyed); Johnson, 1992: 385 (cataloged, type information); Fabritius & Popovici, 2007: 30 (keyed). Gryon prolongatum Kozlov: Kononova & Kozlov, 2008: 323, 348 (treated as valid spe- cies, keyed). A maximalist approach to the systematics of Gryon aetherium DEE Comments. Mineo (1980a) treated G. prolongatum as a junior synonym of G. hun- garicum (Szabé). Kononova & Kozlov (2008) recognized the synonymy of Gryon pro- longatus Kozlov and Gryon |Pannongryon] hungaricum (Szabo) but incorrectly used G. prolongatum as the valid name. Gryon insidiosum Mineo Holotype images: https://zenodo.org/record/4505396#. YByVHX1OlaQ, Gryon insidiosum Mineo, 1991: 27 (original description, assigned to myrmecophilum species group). Gryon insulare (Dodd), comb. nov. Holotype images: https://zenodo.org/record/472 1645#.YIcRvlKhaQ. Telenomoides insularis Dodd, 1913a: 169, 171 (original description. Preoccupied by Hadronotus insularis Ashmead (1894)). Hadronotus assimilis Dodd: Dodd, 1914a: 129 (replacement name, generic name); Dodd, 1915: 20 (keyed); Kieffer, 1926: 456, 472 (description, keyed). Mirotelenomus assimilis (Dodd): Dodd, 1926: 313 (generic transfer); Galloway, 1976: 96 (type information); Johnson, 1992: 439 (cataloged, type information). Gryon assimile (Dodd): Caleca & Mineo, 1995: 19 (generic transfer). Comments. The 4-merous clava, shape of the clypeus, bidentate mandibles with large teeth, and fine sculpture of the head and dorsal mesosoma are visible in the slide mounted holotype female. Transfer of Hadronotus insularis Ashmead from Gryon back to Hadronotus makes the replacement species name “assimile” no long- er necessary. Gryon investe (Kieffer) Plastogryon investis Kieffer, 1908: 143 (original description. Synonymized by Masner (1961)); Masner, 1961: 160 (junior synonym of Gryon misellus Haliday). Plastogryon Investis Kieffer: Kieffer, 1913: 249 (description). Plastogryon (Heterogryon) investis Kieffer: Kieffer, 1926: 446, 449 (description, subge- neric assignment, keyed). Gryon investis (Kieffer): Kozlov, 1978: 620 (description); Kozlov & Kononova, 1989: 79 (keyed); Kozlov & Kononova, 1990: 267, 277 (description, keyed); Kononova, 1995: 81 (keyed); Kononova & Petrov, 2002: 55 (keyed). Gryon investe (Kieffer): Kononova & Kozlov, 2008: 326, 377 (treated as valid species, description, keyed); Timokhov, 2019b: 47 (catalog of species of Russia). 378 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) Comments. The treatment of Plastogryon investis as a junior synonym of Gryon misel- lum by Masner (1961) indicates that, at the least, they are congeneric. Gryon josephinae Mineo Holotype images: https://zenodo.org/record/4507012#.YB1W_nlOlaQ Gryon Josephinae Mineo, 1991: 27 (original description, assigned to myrmecophilum species group). Gryon josephinae Mineo: Mineo & Caleca, 1994: 119 (distribution). Gryon justum Kozlov & Kononova Gryon justus Kozlov & Kononova, 1989: 80, 93 (original description, keyed); Kozlov & Kononova, 1990: 268, 291 (description, keyed); Kononova & Petrov, 2002: 55 (keyed). Gryon justum Kozlov & Kononova: Johnson, 1992: 385 (cataloged, type information); Kononova & Kozlov, 2008: 329, 404 (description, keyed). Comments. This species remains in Gryon based on a character listed in the original description “The frontal impression is deep, not striate.” Gryon kaszabi (Mineo), comb. nov. Eremioscelio kaszabi Mineo, 1979c: 269 (original description); Johnson, 1992: 373 (cataloged, type information). Comments. Mineo (1991) transferred Eremioscelio cydnoides (type species of Eremios- celio) to Gryon, implicitly treating Eremioscelio as a junior synonym. A few characters in the original description of E. kaszabi confirm this placement, “club with four joints”, “cheeks and surface of frons...finely, fan-like striate.” Gryon elegans Kononova Gryon elegans Kononova, 2001: 1478 (original description); Kononova & Petrov, 2002: 56 (keyed); Kononova & Kozlov, 2008: 331, 423 (description, keyed). Gryon kononovai Ozdikmen: Ozdikmen, 2011: 771 (replacement name for Gryon el- egans Kononova). Comments. The original description provides some evidence for leaving this species in Gryon, “The head sculpture is fine-grained, resembles fine emery.” Our transfer of A maximalist approach to the systematics of Gryon aetherium ee) Plastogryon elegans Dodd to Hadronotus eliminates the need for the replacement name Gryon kononovai. Gryon lada Kozlov Holotype images: https://zenodo.org/record/5600220#.YXgUgfnMJaQ. Gryon lada Kozlov, 1972: 651 (original description); Kozlov & Kononova, 1989: 81 (keyed); Kozlov & Kononova, 1990: 269, 305 (description, keyed); Johnson, 1992: 386 (cataloged, type information); Kononova, 1995: 81 (keyed); Kon- onova & Petrov, 2002: 57 (keyed); Kononova & Kozlov, 2008: 333, 438 (de- scription, keyed). Gryon laetum Kozlov & Kononova Gryon laetum Kozlov & Kononova, 2004: 201 (original description); Kononova & Kozlov, 2008: 332, 432 (description, keyed). Comments. Figure 1—4 in the original description matches the distinct habitus found in many species of Gryon (e.g., G. myrmecophilum) and illustrates a striate interior of the axillula, which is a diagnostic character for the genus. Gryon lala Kozlov Holotype images: https://zenodo.org/record/5600277#.YXgWBvnMJaQ Gryon lala Kozlov, 1972: 652 (original description); Mineo, 1980a: 197 (system- atic relationships); Kozlov & Kononova, 1989: 79 (keyed); Kozlov & Kononova, 1990: 267, 288 (description, keyed); Johnson, 1992: 386 (cataloged, type infor- mation); Kononova, 1995: 84 (keyed); Kononova & Petrov, 2002: 54 (keyed); Fabritius & Popovici, 2007: 26, 66 (keyed); Kononova & Kozlov, 2008: 326, 376 (description, keyed). Gryon lamia (Kozlov), comb. nov. Holotype images: https://zenodo.org/record/5600383#.YXgYLfnMJaQ Eremioscelio lamia Kozlov, 1972: 655, 656 (original description, keyed); Kozlov & Kononova, 1990: 311, 315 (description, keyed); Johnson, 1992: 373 (cataloged, type information); Kononova, 1995: 85 (keyed); Kononova & Kozlov, 2008: 452, 455 (description, keyed, generic transfer); Timokhov, 2019b: 47 (catalog of species of Russia). 380 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) Gryon largi (Ashmead) Lectotype images in MBD: USNMENT00989858 Hadronotus largi Ashmead, 1893: 230, 231 (original description); Brues, 1910: 47 (keyed); Kieffer, 1926: 454, 462 (description, keyed). Gryon largi (Ashmead): Muesebeck & Masner, 1967: 299 (generic transfer); Masner & Muesebeck, 1968: 35 (lectotype designation); Masner, 1983: 135, 169 (descrip- tion, keyed); Johnson, 1992: 386 (cataloged, type information). Gryon latum (Kozlov), comb. rev. Holotype images: https://zenodo.org/record/5600360#.YXgXB_nMJaQ. Mirotelenomus latus Kozlov, 1963a: 356 (English translation of original description, keyed); Kozlov, 1963b: 664 (original description, keyed, preoccupied by Austro- scelio latus Dodd, 1916); Kozlov, 1978: 621 (description); Johnson, 1992: 392 (type information). Gryon latus (Kozlov): Mineo, 1979a: 255 (generic transfer). Exon latus (Kozlov): Masner, 1980: 22 (generic transfer); Kozlov & Kononova, 1990: 308, 309 (description, keyed); Kononova & Petrov, 2002: 57 (keyed). Gryon latum (Kozlov): Mineo & Caleca, 1987b: 49, 50 (diagnosis, keyed). Gryon kozlovi Mineo: Mineo, 1990a: 171 (unnecessarily proposed replacement name). Exon latum (Kozlov): Kononova & Kozlov, 2008: 447 (description, keyed, generic transfer). Comments. Our treatment of Exon as a junior synonym of Gryon implicitly transfers this species. Gryon lena Kozlov Holotype images: https://zenodo.org/record/5600372#.YXgXmvnMJaQ. Gryon lena Kozlov, 1972: 655 (original description); Kozlov & Kononova, 1989: 80 (keyed); Kozlov & Kononova, 1990: 268, 289 (description, keyed); Johnson, 1992: 386 (cataloged, type information); Kononova & Petrov, 2002: 55 (keyed); Kononova & Kozlov, 2008: 328, 398 (description, keyed). Comments. This species remains in Gryon based on the redescription in Kozlov & Kononova (1990): “The frontal depression above the antennae is deep, with finely sculpted sculpture. The head sculpture is fine-grained.” However, we consider it neces- sary for the holotype specimen to be examined for confident placement. A maximalist approach to the systematics of Gryon aetherium 381 Gryon longipenne (Dodd) Platyteleia longipennis Dodd, 1913c: 335 (original description); Kieffer, 1926: 409 (de- scription, keyed); Galloway, 1976: 101 (type information). Gryon longipennis (Dodd): Galloway & Austin, 1984: 79 (generic transfer). Gryon longipenne (Dodd): Mineo, 1990b: 58 (type information); Johnson, 1992: 387 (cataloged, type information). Comments. Generic placement cannot be determined from the original description and examination of the holotype is needed. Gryon lymantriae (Masner), comb. rev. Hadronotus lymantriae Masner, 1958: 39, 42 (original description, keyed). Gryon lymantriae (Masner): Masner, 1965: 77 (type information, generic transfer); Mi- neo, 1979a: 257 (description); Johnson, 1992: 387 (cataloged, type information); Mineo & Caleca, 1994: 127, 128 (distribution, keyed, synonymy). Masneria lymantriae (Masner): Szab6, 1966: 442 (description of male and female, ge- neric transfer). Eremioscelio lymantriae (Masner): Kozlov, 1972: 657 (generic transfer, keyed); Ko- zlov, 1978: 622 (description); Livshits & Kuslitskii, 1989: 49 (keyed); Kozlov & Kononova, 1990: 311, 316 (description, keyed); Fabritius & Popovici, 2007: 36 (description, keyed); Kononova & Kozlov, 2008: 452, 456 (description, keyed, generic transfer); Timokhov, 2019b: 47 (catalog of species of Russia). Gryon maculatum Kozlov & Kononova Gryon maculatum Kozlov & Kononova, 2004: 201 (original description); Kononova & Kozlov, 2008: 328, 400 (description, keyed); Timokhoy, 201 9b: 47 (catalog of species of Russia). Comments. The original description suggests that this species belongs in Gryon, but is not entirely clear, “The head is fine-grained. The second impression is distinct, with a longitudinal carina, in fine-grained ornamentation.” Gryon magnum Kozlov & Kononova Gryon magnus Kozlov & Kononova, 1989: 81, 99 (original description, keyed); Kozlov & Kononova, 1990: 269, 304 (description, keyed); Kononova & Petrov, 2002: 57 (keyed). 382 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) Gryon magnum Kozlov & Kononova: Johnson, 1992: 388 (cataloged, type informa- tion); Kononova & Kozlov, 2008: 333, 436 (description, keyed). Comments. This species remains in Gryon based on the original description: “The frontal depression is shallow, with finer, significantly smoothed granularity. The fore- head and the vertex are coarse-grained.” Gryon marina Kozlov & Kononova Gryon marina Kozlov & Kononova, 1989: 81, 97 (original description, keyed); Kozlov & Kononova, 1990: 269, 301 (description, keyed); Johnson, 1992: 388 (cataloged, type information); Kononova, 1995: 85 (keyed); Kononova & Petrov, 2002: 56 (keyed); Kononova & Kozlov, 2008: 332, 433 (description, keyed); Timokhov, 2019b: 47 (catalog of species of Russia). Comments. We consider it best to leave this species in Gryon based on characters in the original description, “Ihe head is finely meshed” and “Cheeks from above in thin longitudinal wrinkles.” Gryon medium Kononova & Petrov Gryon medius Kononova & Petrov, 2001: 1476 (original description); Kononova & Petrov, 2002: 55 (keyed). Gryon medium Kononova & Petrov: Kononova & Kozlov, 2008: 327, 386 (description, keyed). Comments. The original description illustrates a female antenna with four clavomeres and describes the sculpture of the frontal depression as “smoothed.” Gryon menthes Kozlov & Lé Holotype images in MBD: ZIN 0092; Paratype images in MBD: UINMENT01223670 Gryon menthes Kozlov & Lé, 1992: 220, 221 (original description, assigned to misellum species group, keyed). Gryon menthis Kozlov & Lé, 1996: 9 (description); Lé, 2000: 96, 123 (description, keyed, type information). Comments. Images of the paratype specimens show the presence of striation of the axillula and the lateral pit on T1. A maximalist approach to the systematics of Gryon aetherium 383 Gryon micropterum (Kieffer) Hadronotus brevipennis Kieffer, 1909: 270 (original description. Preoccupied by Had- ronotus brevipennis Harrington (1900)). Hadronotus Micropterus (Kieffer): Kieffer, 1913: 244 (replacement name). Hadronotus micropterus (Kieffer): Kieffer, 1926: 453, 457 (description, keyed); Bin, 1974: 455 (type information). Gryon micropterus (Kieffer): Johnson, 1992: 388 (cataloged, type information). Comments. The original description is insufficient for generic placement. We leave this species in its current placement until the holotype can be examined. Gryon minutum Mineo Holotype images: https://zenodo.org/record/4508843#. YJLuMaEpBaQ Gryon minimum Mineo, 1990a: 173 (original description. Preoccupied by Hadronotus minimus Kieffer (1908)); Johnson, 1992: 388 (cataloged, type information). Gryon minutum Mineo: Mineo, 1991: 7 (replacement name for Gryon minimum Mi- neo, assigned to artum species group). Gryon minimum (Kieffer) Hadronotus minimus Kieffer, 1908: 35 (original description); Kieffer, 1926: 455, 467 (description, keyed). Gryon minimus (Kieffer): Alayo Dalmau, 1973: 99 (cataloged). Gryon minimum (Kieffer): Johnson, 1992: 388 (cataloged). Comments. The original description suggests that this species belongs in Gryon and so we leave it here for now, albeit without great confidence: “head wider than thorax, slightly arched back, twice as wide as long, smooth and shiny on the front which gives an unlimited frontal impression, finely chagrined on the rest.” Gryon mirum Kononova & Petrov Gryon mirus Kononova & Petrov, 2001: 1477 (original description); Kononova & Petrov, 2002: 55 (keyed). Gryon mirum Kononova & Petrov: Kononova & Kozlov, 2008: 327, 389 (description, keyed). Comments. This species remains in Gryon based on the original description, “frontal impression with granular, strongly smoothed sculpture, shining.” 384 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) Gryon misellum Haliday Figures 21—25; Lectotype images: https://zenodo.org/record/4498847#.YB2OJmFKhaQ, Paralectotype images: https://zenodo.org/record/4724052#. YIh-SPlKhaQ Gryon misellum Haliday, 1833: 271 (original description, keyed); Kieffer, 1926: 261 (de- scription, keyed); Mineo, 1980a: 197 (variation); Masner, 1983: 135, 165 (descrip- tion, keyed); Mineo & Caleca, 1987b: 44 (taxonomic status of Nearctic specimens); Mineo, 1990: 54 (distribution); Johnson, 1992: 388 (cataloged, type information); Mineo & Caleca, 1994: 120 (distribution); Pintureau & al-Nabhan, 2003: 2 (descrip- tion, new distribution record from Portugal and France); Kononova & Kozlov, 2008: 326, 378 (description, keyed); Timokhov, 2019b: 47 (catalog of species of Russia). Teleas pumilio Nees von Esenbeck, 1834: 288 (original description. Synonymized by Masner (1961)); Dalla Torre, 1898: 519 (generic transfer); Masner, 1961: 160 (junior synonym of Gryon misellus Haliday). Gryon misellus Haliday: Walker, 1836: 344 (description, emendation); Kieffer, 1908: 190 (description); Masner, 1961: 160 (description, synonymy, lectotype designation); Kozlov, 1963a: 357, 358 (description, keyed); Kozlov, 1963b: 667 (description, keyed); Hellén, 1971: 21 (description); Kozlov, 1978: 620 (description); Kozlov & Kononova, 1989: 79 (keyed); Kozlov & Kononova, 1990: 267, 278 (description, keyed); Kononova, 1995: 81 (keyed); Kononova & Petrov, 2002: 55 (keyed); Fabritius & Popovici, 2007: 15, 26 (description, keyed). Teleas misellus (Haliday): Blanchard, 1840: 290 (description, generic transfer). Telenomus divisus Wollaston, 1858: 25 (original description. Synonymized by Graham (1984)); Kieffer, 1926: 39 (description); Johnson, 1992: 388 (type information). Acolus basalis Thomson, 1859: 422 (original description. Synonymized by Masner (1961)); Masner, 1961: 160 (junior synonym of Gryon misellus Haliday). Acolus opacus Thomson, 1859: 422 (original description. Synonymized by Masner (1961)); Masner, 1961: 160 (junior synonym of Gryon misellus Haliday). Gryon pumilio (Nees von Esenbeck): Mayr, 1879: 698 (generic transfer). Plastogryon Forsteri Kieffer, 1908: 141 (original description. Synonymized by Masner (1961)); Kieffer, 1913: 246 (description); Masner, 1961: 160 (junior synonym of Gryon misellus Haliday). Plastogryon pumilio (Nees von Esenbeck): Kieffer, 1908: 144 (generic transfer). Plastogryon sagax Kieffer, 1908: 142 (original description. Synonymized by Masner (1961)); Masner, 1961: 160 (junior synonym of Gryon misellus Haliday). Plastogryon sagax var. brevipennis Kieffer, 1908: 143 (original description. Synonymized by Masner (1961)); Masner, 1961: 160 (junior synonym of Gryon misellus Haliday). Acoloides basalis (Thomson): Brues, 1908: 17 (diagnosis, list of species). Acoloides opacus (Thomson): Brues, 1908: 17 (diagnosis, list of species). Paragryon ? Misellus (Haliday): Kieffer, 1910: 99 (generic transfer). Holacolus Basalis (Thomson): Kieffer, 1912: 107 (description, generic transfer). Holacolus Opacus (Thomson): Kieffer, 1912: 107 (description, generic transfer). Gryon Misellus Haliday: Kieffer, 1913: 214 (description). A maximalist approach to the systematics of Gryon aetherium 385 Gryon Walkeri Kieffer, 1913: 216 (original description. Synonymized by Masner (1961)); Masner, 1961: 160 (junior synonym of Gryon misellus Haliday). Plastogryon Brevipennis Kieffer: Kieffer, 1913: 247 (description). Plastogryon Pumilio (Nees von Esenbeck): Kieffer, 1913: 247 (description). Plastogryon Sagax Kieffer: Kieffer, 1913: 249 (description). Hadronotus divisus (Wollaston): Dodd, 1920a: 351 (generic transfer). Gryon walkeri Kieffer: Kieffer, 1926: 261, 262 (description, keyed). Holacolus basalis (Thomson): Kieffer, 1926: 170 (description, keyed). Holacolus opacus (Thomson): Kieffer, 1926: 170 (description, keyed). Plastogryon (Heterogryon) brevipennis Kieffer: Kieffer, 1926: 446, 448 (description, sub- generic assignment, keyed). Plastogryon (Heterogryon) pumilio (Nees von Esenbeck): Kieffer, 1926: 446, 449 (de- scription, subgeneric assignment, keyed). Plastogryon (Heterogryon) sagax Kieffer: Kieffer, 1926: 446, 448 (description, subge- neric assignment, keyed). Plastogryon (Plastogryon) foersteri Kieffer: Kieffer, 1926: 446, 447 (description, subge- neric assignment, keyed). Gryon divisus (Wollaston): Masner, 1965: 75 (type information, generic transfer). Gyron misellum Haliday: O’Connor, Nash, Notton & Fergusson, 2004: 25 (misspell- ing, catalog of Irish species). Gryon moczari (Szabé), comb. nov. Figures 35-40; Holotype images in MBD: Hym.Typ.No. 9634, Mus.Budapest Hungarogryon moczari Szabo, 1966: 443 (original description); Kozlov, 1978: 621 (de- scription); Mineo, 1979: 261 (figure); Kozlov & Kononova, 1990: 320 (keyed); Johnson, 1992: 402 (cataloged, type information); Mineo, 2005: 34 (new distri- bution record, host presumption); Kononova & Kozlov, 2008: 462 (description). Comments. See generic synonymy. Gryon monspeliense (Picard) Holotype images: https://zenodo.org/record/4509056#.YB2PYGFKhaQ Lectotype images: https://zenodo.org/record/5600406#.YXgZFPnMJaQ Hadronotus monspeliensis Picard, 1924: 107 (original description). Hadronotus afanasievi Meier, 1949: (original description. reference from Kozlov (1963c). Synonymized by Kozlov (1978)). Hadronotus afanassievi Meier: Ryakhovskii, 1959: 81 (description). Hadronotus telengai Ryakhovskii, 1959: 81, 84 (original description, keyed. Syn- onymized by Kozlov (1963c)); Kozlov, 1963c: 295 (junior synonym of Gryon afa- nasievi (Meier)); Johnson, 1992: 389 (type information). 386 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) Gryon afanasievi (Meier): Kozlov, 1963c: 295, 296 (description). Hadronotellus monspeliensis (Picard): Szabd, 1966: 423, 427 (description, generic transfer, keyed). Gryon monspeliensis (Picard): Mineo, 1977: 82 (description of preimaginal stages); Kozlov, 1978: 619 (description, generic transfer); Mineo, 1979a: 258 (type information); Mineo, 1979b: 94 (keyed); Kozlov & Kononova, 1989: 80 (keyed); Kozlov & Kononova, 1990: 268, 299 (description, keyed); Kononova & Petrov, 2002: 56 (keyed); Fabritius & Popov- ici, 2007: 16, 32 (description, keyed); Timokhov, 2019b: 47 (catalog of species of Russia). Gryon laraichii Mineo: Mineo, 1979b: 94 (original description, keyed); Mineo, 1979a: 255 (description); Johnson, 1992: 386 (cataloged, type information); Mineo & Caleca, 1994: 121 (distribution, assigned to subfasciatum group); Kononova & Kozlov, 2008: 429 (junior synonym of Gryon monspeliense (Picard)). Gryon monspeliense (Picard): Johnson, 1992: 389 (cataloged, type information); Mineo & Caleca, 1994: 121 (distribution, assigned to subfasciatum group); Kononova & Kozlov, 2008: 332, 429 (description, keyed, synonymy). Gryon montanum (Kieffer) Hadronotus montanus Kieffer, 1906: 5 (original description). Hadronotus? montanus Kieffer: Kieffer, 1908: 145 (redescribed as new). Psiloteleia montanus (Kieffer): Kieffer, 1926: 452 (description, keyed). Gryon montanus (Kieffer): Mani & Sharma, 1982: 192 (generic transfer). Gryon montanum (Kieffer): Johnson, 1992: 390 (cataloged). Comments. Generic placement cannot be made from the original description. We leave this species in its current designation until the holotype specimen can be examined. Gryon muscorum Kozlov & Kononova Gryon muscorum Kozlov & Kononova, 2004: 202 (original description); Kononova & Kozlov, 2008: 327, 380 (description, keyed). Comments. We were unable to determine the generic placement of this species, and thus it remains in Gryon until the holotype specimen can be examined. Gryon myrmecophilum (Ashmead) Holotype images in MBD: USNMENT00989861 Hadronotus myrmecophilus Ashmead, 1893: 230, 232 (original description, keyed); Brues, 1910: 47 (keyed); Kieffer, 1926: 454, 462 (description, keyed). A maximalist approach to the systematics of Gryon aetherium 387 Gryon myrmecophilus (Ashmead): Muesebeck & Masner, 1967: 299 (generic transfer); Masner & Muesebeck, 1968: 36 (type information). Gryon myrmecophilum (Ashmead): Masner, 1983: 135, 170 (description, emendation, keyed); Johnson, 1992: 390 (cataloged, type information). Gryon nigriceps (Dodd) Holotype images: https://zenodo.org/record/4509346#.YB2ZMHIOlaQ Hadronotus nigriceps Dodd, 1914b: 81 (original description); Dodd, 1915: 19 (keyed); Kieffer, 1926: 455, 469 (description, keyed). Mirotelenomus nigriceps (Dodd): Dodd, 1926: 313 (generic transfer); Galloway, 1976: 109 (type information). Gryon nigriceps (Dodd): Galloway & Austin, 1984: 79 (generic transfer); Johnson, 1992: 391 (cataloged, type information). Comments. The head of the holotype male is slide-mounted and crushed. However, the distinctive shape of the clypeus found in Gryon and facial striae are visible on both sides of the head. The image of the dorsal meso- and metasoma shows the carina on T1 that is directly medial to the lateral pit that is diagnostic for Gryon, although the pit itself is not visible. This image also appears to show a subgenual spine on the right tibia. Gryon nitens (Szabé) Holotype images in MBD: Hym.Typ.No. 9630, Mus.Budapest Sundholmia nitens Szab6, 1966: 439 (original description. Synonymized by Mineo & Caleca (1987b)). Gryon nitens (Szabd): Mineo, 1980a: 200 (generic transfer, description); Johnson, 1992: 392 (cataloged, type information). Comments. Most of the diagnostic characters that place this species in Gryon are visible in the holotype but the specimen is not entirely clean. In lateral view, the subgenual spines are apparent and the metapleuron is not dorsoventrally di- vided by a change in sculpture or setation. In dorsal view, the striation is visible in the anterior portion of the axillar crescent and the foveae along the anterior margin of T1 are uniform in size, ending sublaterally in a carina. The lateral pit on T1 is obscured. The anterolateral view of the head illustrates that the frons does not have macrosculpture. Gryon nosulcum Kozlov & Lé Holotype images in MBD: IEBR 0173 388 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) Gryon nosulcum Kozlov & Lé, 1992: 212, 221 (original description, assigned to misel- lum species group, keyed). Gryon nosulcus Kozlov & Lé, 1996: 10 (description); Lé, 2000: 97, 128 (description, keyed, type information). Gryon obscurum Mineo Holotype images: https://zenodo.org/record/4509680#.YB2-UX1OlaQ Gryon obscurum Mineo, 1991: 27 (original description, assigned to myrmecophilum species group). Gryon oligomerum Kononova Paratype images: https://zenodo.org/record/5176809#.YRK9|cpKhaQ. Gryon oligomerum Kononova: Kononova, Pavlicek & Nevo, 2005: 816 (description); Kononova, Pavlicek & Nevo, 2005: 1358 (original description); Kononova & Ko- zlov, 2008: 329, 406 (description, keyed). Comments. Figures 6—1 and 6—2 in the original description illustrate the anterior head and the female antenna, both of which indicate that this species belongs in Gryon. The holotype specimen is mounted in a way that prevents observation of the lateral mesosoma (Cristina Vasilita, personal communication), but the pres- ence of a complete mesopleural carina is visible on some of the paratype speci- mens, which have identical collection data. Also, in the paratype specimen pho- tographed, the acetabular carina and ventral mesopleural carina do not intersect ventrally, providing another character by which this species may be separated from G. aetherium. The medial infuscation of the fore wing, illustrated in Figure 5—1 of the original description, is similar to that of G. fasciatum, which was described from Egypt. Because G. oligomerum was described from Israel, these species should be compared in future work. Gryon paradigma Mineo Figures 26—28; Holotype images: https://zenodo.org/record/4519703#.YCFmDX1OlaQ. Gryon paradigma Mineo, 1991: 29 (original description, assigned to myrmecophilum species group). Comments. Females of this species have 11 antennomeres. Figure 12 in the original description illustrates this and the number of antennomeres can also be counted in the images of the holotype specimen. However, in the original description Mineo (1991) A maximalist approach to the systematics of Gryon aetherium 389 stated, “Female... antenna, excluding A9-A12 brown,” indicating that he might not have been aware of this antennal character. Gryon parafasciatum Mineo Holotype images: https://zenodo.org/record/4519716#.YCFn531OlaQ Gryon parafasciatum Mineo, 1991: 30 (original description, assigned to myrmecophilum species group). Gryon parkeri (Fouts) Holotype images in MBD: USNMENT00989862 Hadronotus parkeri Fouts, 1920: 64 (original description). Gryon parkeri (Fouts): Muesebeck & Masner, 1967: 299 (generic transfer); Masner & Muesebeck, 1968: 36 (type information); Masner, 1983: 135, 167 (description, keyed); Johnson, 1992: 393 (cataloged, type information). Gryon patroclus Mineo Holotype images: https://zenodo.org/record/4519784#.YCFq_XlOlaQ Gryon patroclus Mineo, 1994: 119 (original description, assigned to myrmecophilum group). Gryon pedestre (Nees von Esenbeck) Syntype images in MBD: ZMUC 0002 Teleas pedestris Nees von Esenbeck, 1834: 293 (original description); Graham, 1988: 33 (publication of drawing by Westwood of Nees's specimen, generic transfer. This change in interpretation of Téleas pedestris may negate some or all of the reported synonymies). Platygaster apterus Nees von Esenbeck, 1834: 299 (original description); Kononova & Kozlov, 2001: 284 (junior synonym of Trimorus pedestris (Nees von Esenbeck)). Prosacantha pedestris (Nees von Esenbeck): Thomson, 1859: 431 (description, generic transfer). Prosacantha subtilis Thomson, 1859: 430 (original description. Synonymized by Szabé (1966)); Szabd, 1966: 46 (junior synonym of Trimorus pedestris (Nees von Esen- beck)); Johnson, 1992: 393 (type information). Hoplogryon Subtilis (Thomson): Kieffer, 1908: 210 (generic transfer, keyed). Hoplogryon pedestris (Nees von Esenbeck): Kieffer, 1908: 202, 212 (generic transfer, keyed). 390 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) Hoplogryon (Hoplogryon) pedestris (Nees von Esenbeck): Kieffer, 1910: 97 (subgeneric assignment); Kieffer, 1926: 183, 186, 189 (description, keyed). Hoplogryon (Hoplogryon) subtilis (Thomson): Kieffer, 1910: 98 (subgeneric assignment); Kieffer, 1926: 186, 201 (description, keyed). Hoplogryon Pedestris (Nees von Esenbeck): Kieffer, 1912: 114, 151 (description). Hoplogryon subtilis (Thomson): Kieffer, 1912: 144 (description). Hadronotellus pedester Kieffer, 1917: 341 (original description); Szabd, 1966: 423, 425 (description, type information, keyed); Hellén, 1971: 23 (description). Hadronotus pedester (Kieffer): Kieffer, 1926: 453, 456 (generic transfer, description, keyed); Meier, 1940: 80 (description, keyed); Ryakhovskii, 1959: 81 (keyed). Platygaster aptera Nees von Esenbeck: Kieffer, 1926: 826 (description, emendation); Vlug, 1995: 48 (cataloged). Trimorus pedestris (Nees von Esenbeck): Szabé, 1966: 25, 46 (description, synonymy, keyed); Fabritius, 1969: 271 (description); Kozlov, 1978: 625 (description); Kon- onova & Kozlov, 2001: 160, 165, 284 (description, keyed, no mention of generic transfer by Graham (1988), synonymy). Trimorus subtilis (Thomson): Sundholm, 1967: 133 (lectotype designation, generic transfer). Gryon pedester (Kieffer): Mineo, 1979b: 96 (keyed). Gryon pedestre (Nees von Esenbeck): Johnson, 1992: 393 (cataloged); Johnson, 1992: 394 (cataloged, type information); Mineo & Caleca, 1994: 121 (distribution, as- signed to subfasciatum group); Buhl, 1997: 42 (description); Fabritius & Popovici, 2007: 14, 18 (description, keyed). Gryon krygeri Buhl: Buhl, 1997: 41 (replacement name for Hadronotellus pedester Kief- fer, preoccupied by Téleas pedestris Nees von Esenbeck, junior synonym of Gryon pedestre (Nees von Esenbeck)). Gryon pisus (Nixon) Holotype images: https://zenodo.org/record/4520662#.YCGHVXIOlaQ Hadronotus pisus Nixon, 1934b: 292, 297 (original description, keyed); Risbec, 1950: 592, 593, 638 (description, variation, keyed). Hadronotus Basilewskyi Risbec, 1957: 140 (original description). Gryon pisus (Nixon): Masner, 1965: 78 (type information, generic transfer). Gryon basilewskyi (Risbec): Masner, 1976: 58 (generic transfer, systematic position); Johnson, 1992: 379 (cataloged, type information). Gryon pisum (Nixon): Mineo, 1991: 32 (emendation, description, synonymy, assigned to myrmecophilum species group); Johnson, 1992: 394 (cataloged, type information). Hadronotus basilewskyi Risbec: Mineo, 1991: 32 (junior synonym of Gryon pisum (Nixon)). Comments. This species was named after Pisus, son of Aphraeus, a character from Greek mythology, and thus the species epithet should be treated as an appositional noun. A maximalist approach to the systematics of Gryon aetherium 391 Gryon politum (Ashmead) Hadronotus politus Ashmead, 1894: 229, 230 (original description, keyed); Ashmead, 1900: 328 (distribution); Kieffer, 1926: 455, 466 (description, keyed). Gryon politus (Ashmead): Masner, 1976: 58 (generic transfer, type information). Gryon politum (Ashmead): Johnson, 1992: 394 (cataloged, type information). Comments. The original description is insufficient for placing this species, and we leave it under its current generic assignment. Gryon prisma Mineo Holotype images: https://zenodo.org/record/4520676#.YCGH7HIOlaQ Gryon prisma Mineo, 1991: 34 (original description, assigned to myrmecophilum spe- cies group); Mineo & Caleca, 1994: 120 (distribution). Gryon psilantere Kozlov & Lé Holotype images in MBD: IEBR 0174 Gryon psilantere Kozlov & Lé, 1992: 213, 221 (original description, assigned to misel- lum species group, keyed). Gryon psilanteris Kozlov & Lé, 1996: 10 (description); Lé, 2000: 97, 130 (description, keyed, type information). Gryon rectum Kozlov & Kononova Gryon rectus Kozlov & Kononova, 1989: 80, 95 (original description, keyed); Kozlov & Kononova, 1990: 268, 297 (description, keyed); Kononova & Petrov, 2002: 56 (keyed); Fabritius & Popovici, 2007: 16, 31 (description, keyed). Gryon rectum Kozlov & Kononova: Johnson, 1992: 395 (cataloged, type information); Kononova & Kozlov, 2008: 332, 427 (description, keyed). Comments. ‘The original description does not list any characters that would exclude this species from Gryon, but confident determination will require examination of the holotype. Gryon regulare Kozlov & Kononova Gryon regularis Kozlov & Kononova, 1989: 80, 92 (original description, keyed); Kozlov & Kononova, 1990: 268, 290 (description, keyed); Kononova & Petrov, 2002: 55 (keyed). 392 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) Gryon regulare Kozlov & Kononova: Johnson, 1992: 395 (cataloged, type informa- tion); Kononova & Kozlov, 2008: 329, 401 (description, keyed). Comments. The original description is consistent with placement of this species in Gryon, especially the following “Cheeks from above are thinly striated longitudinally”. However, examination of the type specimen is needed. Gryon remotum Mineo Holotype images: https://zenodo.org/record/4520735#.YCGJ531OlaQ. Gryon remotum Mineo, 1991: 35 (original description, assigned to myrmecophilum species group). Gryon rubrigaster (Szabo) Holotype images: https://zenodo.org/record/4521199#.YCGeenlOlaQ Pannongryon rubrigaster Szabé, 1966: 435, 437 (original description, keyed). Gryon rubrigaster (Szabo): Mineo, 1979a: 261 (generic transfer, type information); Mi- neo & Szabd, 1979: 272 (description of male); Mineo, 1991: 36 (description, assigned to myrmecophilum species group); Johnson, 1992: 395 (cataloged, type information); Mineo & Caleca, 1994: 120 (distribution); Kononova & Kozlov, 2008: 322, 338 (description, keyed). Gryon rubrum Kononova & Petrov Gryon rubrum Kononova & Petrov, 2001: 1470 (original description); Kononova & Petrov, 2002: 53 (keyed); Kononova & Kozlov, 2008: 323, 346 (description, keyed). Comments. The original description refers to the head sculpture as “fine-grained, strong- ly smoothed” and provides no characters that would lead us to remove it from Gryon. Me p y Gryon rubtzovi (Ryakhovskii) Lectotype images: https://zenodo.org/record/5600418#.YXgZ4vnMJaQ Hadronotus rubtzovi Ryakhovskii, 1959: 81 (original description). Gryon rubtzovi (Ryakhovskii): Kozlov, 1963a: 358 (description, generic transfer, lec- totype designation, keyed); Kozlov, 1963b: 667, 668 (description, keyed, generic transfer, lectotype designation); Johnson, 1992: 395 (cataloged, type information); Mineo & Caleca, 1994: 127 (junior synonym of Gryon lymantriae (Masner)); Kon- A maximalist approach to the systematics of Gryon aetherium 293 onova & Petrov, 2002: 55 (keyed); Kononova & Kozlov, 2008: 328, 392 (treated as valid species, description, keyed, synonymy). Gryon rubtzovi Kozlov & Kononova, 1989: 78, 86 (original description, keyed. An objective junior synonym of Hadronotus rubtzovi Ryakhovskii (1959)); Kozlov & Kononova, 1990: 266, 275 (description, keyed); Johnson, 1992: 395 (cataloged, type information); Kon- onova & Kozlov, 2008: 392 (implicitly synonymized with Gryon rubtzovi (Ryakhovskii)). Gryon rufescens Kozlov & Kononova Gryon rufescens Kozlov & Kononova, 2004: 206 (original description); Kononova & Kozlov, 2008: 328, 393 (description, keyed); Timokhov, 2019b: 48 (catalog of species of Russia). Comments. Our translation of the original description, and the illustrations provided therein, are not sufficient for us to determine the generic placement of this species. Therefore, we leave it in Gryon. Gryon simile Kozlov & Kononova Holotype images: https://zenodo.org/record/4532038#. YCQxiHlOlaQ, Gryon similis Kozlov & Kononova, 1989: 79, 88 (original description, keyed); Kozlov & Kononova, 1990: 267, 279 (description, keyed); Kononova, 1995: 81 (keyed); Kononova & Petrov, 2002: 55 (keyed). Gryon simile Kozlov & Kononova: Johnson, 1992: 396 (cataloged, type information); Kononova & Kozlov, 2008: 326, 378 (description, keyed). Gryon solutum Kononova Gryon solutus Kononova, 2001: 1472 (original description); Kononova & Petrov, 2002: 53 (keyed); Fabritius & Popovici, 2007: 15, 21 (description, keyed). Gryon solutum Kononova: Kononova & Kozlov, 2008: 323, 350 (description, keyed). Comments. We leave this species in Gryon based on the original description, “The head sculpture is fine-grained. The frontal impression is distinct, its sculpture is slightly smoothed.” Gryon sparsum Kozlov & Kononova Gryon sparsum Kozlov & Kononova, 2004: 207 (original description); Konon- ova & Kozlov, 2008: 328, 397 (description, keyed); Timokhov, 2019b: 48 (catalog of species of Russia). 394 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) Comments. The illustrations in the original description are consistent with placement with Gryon. We thus choose to leave it in this genus until direct examination of the holotype can occur. Gryon spennum Kozlov & Lé Holotype images in MBD: IEBR 0146 Gryon spennum Kozlov & Lé, 1992: 212, 221 (original description, assigned to misel- lum species group, keyed). Gryon spennus Kozlov & Lé, 1996: 10 (description); Lé, 2000: 97, 131 (description, keyed, type information). Gryon striatum (Caleca), comb. nov. Breviscelio striatus Caleca, 1992: 49, 52 (original description, keyed). Gryon subfasciatum (Wollaston) Telenomus subfasciatus Wollaston, 1858: 25 (original description); Kieffer, 1926: 40 (description). Hadronotus subfasciatus (Wollaston): Dodd, 1920a: 350 (generic transfer). Gryon subfasciatus (Wollaston): Masner, 1965: 78 (type information, generic transfer); Mineo, 1980a: 201 (description). Gryon subfasciatum (Wollaston): Graham, 1984: 99 (emendation); Johnson, 1992: 396 (cataloged, type information). Comments. Neither the original description nor the redescription by Mineo (1980a) enables unambiguous generic placement. We leave this species in Gryon until the holo- type specimen can be examined. Gryon szaboi Mineo Hadronotellus hungaricus Szabé, 1966: 422, 423 (original description, keyed). Gryon hungaricus (Szabd): Kozlov, 1978: 619 (description, generic transfer); Mineo, 1979a: 250 (variation); Kozlov & Kononova, 1989: 80 (keyed); Kozlov & Konon- ova, 1990: 268, 292 (description, keyed); Kononova & Petrov, 2002: 55 (keyed); Fabritius & Popovici, 2007: 16 (keyed). Gryon szaboi Mineo: Mineo, 1991: 11, 12 (replacement name for Hadronotellus hun- garicus Szabé, description, assigned to ungaricum species group, keyed); Mineo & Caleca, 1994: 120 (distribution). A maximalist approach to the systematics of Gryon aetherium 395 Gryon hungaricum (Szabo): Johnson, 1992: 385 (cataloged, type information); Kozlov & Kononova, 2008: 329, 403 (description, keyed). Comments. We leave this species in Gryon based on Mineo’s (1991) assignment of it to the ungaricum group. Gryon szelenyti (Szabo) Holotype images: https://zenodo.org/record/4521320#.YCGzRnlOlaQ. Pannongryon szelenyii Szabd, 1966: 435 (original description, keyed). Gryon szelenyii (Szabd): Kozlov, 1971: 48, 49 (diagnosis, generic transfer); Kozlov, 1978: 620 (description); Mineo & Szabd, 1978a: 93 (description); Mineo, 1980a: 196 (description); Kozlov & Kononova, 1989: 79 (keyed); Kozlov & Kononova, 1990: 267, 288 (description, keyed); Johnson, 1992: 397 (cata- loged, type information); Kononova & Petrov, 2002: 54 (keyed); Fabritius & Popovici, 2007: 26, 66 (keyed); Kononova & Kozlov, 2008: 326, 375 (descrip- tion, keyed). Pannongryon szelenyi Szabé: Mineo, 1991: 38 (misspelling). Gryon szeleneyi (Szabd): Mineo, 1991: 38 (description, assigned to myrmecophilum spe- cies group, misspelling). Gryon tardum Kononova & Fursov Gryon tardus Kononova & Fursov: Kononova & Fursov, 2005a: 593 (original descrip- tion); Kononova & Fursov, 2005b: 303 (description). Gryon tardum Kononova & Fursov: Kononova & Kozlov, 2008: 330, 410 (description, keyed). Comments. This species remains Gryon based on the original description “Frontal de- pression shallow, smooth, shining, with distinct longitudinal carina, almost reaching the anterior ocellus,” and Figure 1-4 which illustrates the presence of facial striae and a somewhat protruding clypeus. Gryon tauricum Kozlov & Kononova Gryon tauricus Kozlov & Kononova, 1989: 80, 93 (original description, keyed); Kon- onova & Petrov, 2002: 55 (keyed). Gryon tauricum Kozlov & Kononova: Kononova & Kozlov, 2008: 329, 405 (descrip- tion, keyed); Timokhov, 2019b: 47 (catalog of species of Russia). Comments. This species remains Gryon based on the original description. 396 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) Gryon tiliarum (Kononova & Petrov) comb. nov. Exon tiliarum Kononova & Petrov, 2002: 57 (original description, keyed); Kononova & Kozlov, 2008: 447, 450 (description, keyed, generic transfer). Gryon thema Mineo Holotype images: https://zenodo.org/record/4521325#.YCGz931OlaQ. Gryon thema Mineo, 1991: 38 (original description, assigned to myrmecophilum species group); Mineo & Caleca, 1994: 120 (distribution). Gryon tobiasi Kozlov & Kononova Holotype images: https://zenodo.org/record/5600422#.YXgarfnMJaQ. Gryon tobiasi Kozlov & Kononova, 2004: 207 (original description); Konono- va & Kozlov, 2008: 327, 387 (description, keyed); Timokhov, 2019b: 48 (catalog of species of Russia). Gryon triangulum Masner Holotype images in MBD: CNC No. 17018 Gryon triangulum Masner, 1983: 135, 171 (original description, keyed); Sarazin, 1986: 979 (type information); Johnson, 1992: 397 (cataloged, type information). Gryon trjapitzini Kozlov & Kononova Gryon trjapitzini Kozlov & Kononova, 1989: 79, 90 (original description, keyed); Ko- zlov & Kononova, 1990: 267, 283 (description, keyed); Johnson, 1992: 397 (cata- loged, type information); Kononova, 1995: 81 (keyed); Kononova & Petrov, 2002: 55 (keyed); Fabritius & Popovici, 2007: 29, 68 (keyed); Kononova & Kozlov, 2008: 327, 384 (description, keyed); Timokhov, 2019b: 48 (catalog of species of Russia). Comments. This species remains in Gryon based on characters in the original descrip- tion, “Frontal depression shallow, smooth, mirror-shiny. The head is fine-grained.” Gryon turcicum Kononova & Petrov Gryon turcicus Kononova & Petrov, 2001: 1471 (original description); Kononova & Petrov, 2002: 53 (keyed). A maximalist approach to the systematics of Gryon aetherium 397 Gryon turcicum Kononova & Petrov: Kononova & Kozlov, 2008: 323, 347 (descrip- tion, keyed). Comments. The original description of this species is very short and states that the surface sculpture of the head and mesosoma is like that of Gryon rubrum. Gryon ukrainicum (Kozlov & Kononova) comb. nov. Eremioscelio ukrainica Kozlov & Kononova, 1990: 311, 314 (original description, keyed); Johnson, 1992: 373 (cataloged, type information); Fabritius & Popovici, 2007: 36, 40 (description, keyed). Eremioscelio ukrainicus Kozlov & Kononova: Kononova & Kozlov, 2008: 452, 453 (description, keyed); Timokhov, 2019b: 47 (catalog of species of Russia). Gryon valeria Talamas & Timokhov, nom. n. Eremioscelio tauricus Kozlov & Kononova, 1990: 311, 317 (original description, keyed); Johnson, 1992: 373 (cataloged, type information); Fabritius & Popovici, 2007: 36, 38 (description, keyed); Kononova & Kozlov, 2008: 452, 457 (descrip- tion, keyed, generic transfer); Timokhov, 2019b: 47 (catalog of species of Russia). Comments. We transfer this species to Gryon based on its prior placement in Eremioscelio, which results in homonymy with Gryon tauricum Kozlov & Kononova (1989). We here provide a euphonic replacement name, “valeria’, to be treated as a noun in apposition. Gryon verum Kozlov & Kononova Gryon verus Kozlov & Kononova, 1989: 79, 91 (original description, keyed); Kozlov & Kononova, 1990: 267, 284 (description, keyed); Kononova & Petrov, 2002: 54 (keyed). Gryon verum Kozlov & Kononova: Johnson, 1992: 398 (cataloged, type information); Kononova & Kozlov, 2008: 326, 372 (description, keyed). Comments. The description from Kozlov & Kononova (1990) stated, “The frontal impression above the antenna is deep, the granularity of the impression is well pro- nounced.” No mention of transverse striae supports leaving this species in Gryon, but examination of the holotype is needed for confident placement. Gryon xanthogaster (Ashmead) Figures 83-87; Holotype images in MBD: USNMENT00989056 398 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) Acolus xanthogaster Ashmead, 1893: 174 (original description). Psilacolus xanthogaster (Ashmead): Kieffer, 1910: 101 (generic transfer); Kieffer, 1926: 152, 153 (description, keyed). Acoloides xanthogaster (Ashmead): Muesebeck & Walkley, 1951: 696 (generic transfer). Gryon xanthogaster (Ashmead): Muesebeck & Masner, 1967: 299 (generic transfer); Masner & Muesebeck, 1968: 37 (type information); Masner, 1983: 133, 163 (de- scription, keyed); Johnson, 1992: 398 (cataloged, type information). Comments. Masner (1983) described G. xanthogaster as having transverse ridges in the frontal depression and tridentate mandibles, characters that would place this spe- cies in Hadronotus. However, the holotype specimen does not have transverse ridges in the frontal depression (Figure 84). We identified specimens as G. xanthogaster based on their congruence with the morphology of the head and mesosoma of the holotype (Figures 83-85) and the yellow metasoma, as is referenced by the name of this spe- cies. An example of a recently collected specimen of G. xanthogaster is illustrated in Figures 86-87), which shows the striate axillula and lateral pit on T1. We suspect that the concept of G. xanthogaster from Masner (1983) applies to Hadronotus bicolor (Figures 88—91), a species of similar size and color pattern that was originally described from the Caribbean. As was mentioned by Masner (1983), this species is somewhat common in Florida, although we have recorded specimens from Washington, DC. Hadronotus Forster Hadronotus Forster, 1856 stat. rev.: 101, 105 (original description. Type: Hadronotus exsculptus Forster, first included species, keyed. Synonymized by Nixon (1936), Masner (1961)); Walker, 1874: 10 (keyed); Howard, 1886: 172 (keyed); Cres- son, 1887: 248, 314 (catalog of species of U.S. and Canada); Cresson, 1887: 84 (keyed); Ashmead, 1893: 210, 211, 229 (description, keyed, key to species of U.S. and Canada); Ashmead, 1894: 217, 229 (key to species of St. Vincent, keyed); Ashmead, 1896: 265 (keyed); Dalla Torre, 1898: 498 (catalog of spe- cies); Ashmead, 1900: 328 (list of species of West Indies); Ashmead, 1903: 92, 94 (keyed); Kieffer, 1908: 119 (keyed); Brues, 1908: 27, 28, 37, 51 (diagnosis, list of species, keyed); Kieffer, 1910: 65, 81 (description, list of species, keyed); Brues, 1910: 47 (key to species of North America); Kieffer, 1912: 56 (key to species of Seychelles); Dodd, 1913a: 131 (keyed); Kieffer, 1913: 230, 235 (de- scription, key to species of Europe and Algeria); Dodd, 1915: 18 (key to spe- cies of Australia, Java, and Fiji); Brues, 1916: 543, 544 (keyed); Kieffer, 1926: 271, 453 (description, keyed, key to species); Nixon, 1934: 1 (description, key to new species described); Nixon, 1934: 290 (description, key to species of Africa); Jansson, 1939: 172 (keyed); Maneval, 1940: 112, 113 (keyed); Mani, 1941: 20, 26 (catalog of species of India, keyed); Risbec, 1950: 585, 591 (key A maximalist approach to the systematics of Gryon aetherium 399 27] ee Figures 83-87. Gryon xanthogaster 83 holotype female (USNMENT00989056), head and mesosoma, lateral view 84 holotype female (USNMENT00989056), head, anterior view 85 holotype female (USN- MENT00989056), head and mesosoma, dorsal view 86 female (UCFC 026 738), head and mesosoma lateral view 87 female (UCFC 026 738), habitus, dorsolateral view. to species of Ethiopian region, keyed); Muesebeck & Walkley, 1951: 704 (cata- log of species of U.S. and Canada); Muesebeck & Walkley, 1956: 357 (citation of type species); Masner, 1958: 42 (status of subgenera, delimitation of species groups); Masner, 1961: 158 (junior synonym of Gryon Haliday); Szabéd, 1966: 421, 429 (description, key to Palearctic species known to the author, keyed); Baltazar, 1966: 182 (cataloged, catalog of species of the Philippines); Hellén, 1971: 5, 22 (description, keyed); Carpenter, 1992: 471 (fossil references). 400 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) 91 te Figures 88-91. Hadronotus bicolor 88 holotype female (USNMENT01109345), head and mesosoma, lateral view 89 holotype female (USNMENT01109345), head, anterodorsal view 90 holotype female (USNMENT01109345), habitus, dorsal view 91 female (FSCA 00091193), dorsolateral view. Comments. The holotype specimen of Hadronotus exsculptus is missing its head (Figures 92-94), but the morphology of the mesosoma and metasoma clearly match the generic concept that we associate with Clade B: T1 without lateral pit (Figure 93), hind tibia without subgenual spines (Figure 94), metapleuron setose (Figure 94). The nearly parallel arrangement of the acetabular carina and mesopleural carina, and transverse shape of foveae in the prespecular sulcus are characters known to us from other species of Hadronotus and will be useful for treating H. exsculptus at the species level in future studies. Muscidea Motschoulsky, 1863 syn. n.: 70 (original description. Type: Muscidea pu- bescens Motschoulsky, by monotypy. Synonymized by Masner (1976)); Ashmead, 1904a: 326 (keyed); Masner, 1976: 57 (junior synonym of Gryon Haliday). Hadronotoides Dodd, 1913b syn. n.: 171 (original description. Type: Hadronotus pen- tatomus Dodd, by monotypy and original designation. Treated as junior synonym of Gryon by Caleca (1990)); Kieffer, 1926: 266, 474 (description, keyed, key to species); Brues, 1940: 81 (description); Mani, 1941: 19, 27 (catalog of species of India, keyed); Muesebeck & Walkley, 1956: 357 (citation of type species); Masner, 1976: 7, 59 (description, keyed); Mani & Sharma, 1982: 151 (keyed); Mineo & Villa, 1982b: 175 (taxonomic value of pleural structures, clypeus, and antennal sensilla); Mineo & Villa, 1982a: 139 (taxonomic value of structures on the poste- rior surface of the head); Galloway & Austin, 1984: 6, 81 (diagnosis, list of species A maximalist approach to the systematics of Gryon aetherium 401 described from Australia, keyed); Johnson, 1992: 398 (cataloged, catalog of world species); Carpenter, 1992: 471 (fossil references). Platyteleia Dodd, 1913a syn. n.: 131, 153 (original description. Type: Platyteleia latipennis Dodd, by monotypy and original designation); Dodd, 1914b: 79 (description); Kieffer, 1926: 269, 408 (description, keyed, key to species); Muesebeck & Walkley, 1956: 386 (citation of type species); Masner, 1958: 42 (status of subgenera, delimitation of species groups); Masner, 1961: 158 (junior synonym of Gryon Haliday); Szabé, 1966: 421, 429 (description, key to Palearctic species known to the author, keyed); Baltazar, 1966: 182 (cataloged, catalog of species of the Philippines); Hellén, 1971: 5, 22 (description, keyed); Galloway & Austin, 1984: 78 (junior synonym of Gryon Haliday); Carpenter, 1992: 471 (fossil references). Telenomoides Dodd, 1913a syn. n. : 158, 168 (original description. Type: Telenomoides flavipes Dodd, by original designation. Key to species of Australia, keyed); Muese- beck & Walkley, 1956: 402 (citation of type species). Comments. Mineo (1990a) treated Telenomoides flavipes as a junior synonym of Gryon orestes (Dodd), implicitly making Telenomoides a junior synonym of Gryon. Exami- nation of the holotype specimen leads us to treat Telenomoides as a junior synonym of Hadronotus based on the presence of five clavomeres, the shape of the clypeus, and the form of foveae along anterior T1. Notilena Bréthes, 1913 syn. n.: 84 (original description. Type: Notilena Gallardoi Bréthes, by monotypy and original designation); Muesebeck & Walkley, 1956: 375 (citation of type species); De Santis & Esquivel, 1966: 96 (junior synonym of Gryon Haliday). Comments. We remove Notilena from Gryon and treat it as a synonym of Had- ronotus based on characters in the original description, “Capite punctato-um- bilicato, facie longitrorsum impressa, utrinque transverse striata et in medio antennas versus longitrorsum cristata,’ which we interpret to indicate that the sculpture of the head is punctate-umbilicate and that the antennal scrobe has transverse striation. Austroscelio Dodd, 1914c syn. n.: 93 (original description. Type: Sparasion nigricoxa Dodd, by original designation. Synonymized by Galloway, in Galloway & Austin (1984)); Kieffer, 1926: 266, 473 (description, keyed, key to species); Muesebeck & Walkley, 1956: 334 (ci- tation of type species); Galloway & Austin, 1984: 78 (junior synonym of Gryon Haliday). Hadrophanurus Kieffer, 1926 syn. n.: 15, 130 (original description. Type: Zéelenomus pennsylvanicus Ashmead, by monotypy, keyed. Synonymized by Masner (1961)); Muesebeck & Walkley, 1951: 694 (catalog of species of U.S. and Canada); Muese- beck & Walkley, 1956: 357 (citation of type species); Masner, 1961: 158 (junior synonym of Gryon Haliday); Subba Rao & Chacko, 1962: 479 (key to species). Diagnosis. Sculpture of head and mesosoma highly variable, ranging from coriaceous microsculpture to coarsely areolate or rugose; mandibular dentition variable, teeth of unequal size; clypeus not projecting; ventral frons without facial striae; antennal scrobe with macrosculpture ranging from transversely striate to areolate rugose; anten- 402 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) Figures 92-94. Hadronotus exsculptus, holotype female (NHMW-HYM #0002996), mesosoma and metasoma 92 posterodorsal view 93 dorsal view 94 lateral view. nal scrobe often delimited by carinae; female antenna with 10 flagellomeres, four to seven clavomeres; sculpture of mesoscutum and mesoscutellum variable, ranging from coriaceous microsculpture to coarsely areolate, striate or rugose; epomial carina vari- able, sometimes extending dorsally to pronotal shoulder; netrion absent; mesoscutal humeral sulcus and mesoscutal suprahumeral sulcus variable: absent or indicated by a furrow or line of foveae; mesoscutum with or without humeral pit; sculpture of axil- lula variable, sometimes with parallel carina between coarse foveae, but not distinctly striate; metapleuron divided dorsoventrally by a change in sculpture or setation; hind tibia without subgenual spines; foveae along anterior [1 decreasing in size laterally, not bordered laterally by a carina or pit. Comments. Hadronotus is morphologically variable and to our knowledge is not united by any single character. Species of Hadronotus Hadronotus achille (Mineo), comb. nov. Holotype images: https://zenodo.org/record/4498931#.YBr9QnlOlaQ A maximalist approach to the systematics of Gryon aetherium 403 Gryon achille Mineo, 1992: 25 (original description). Hadronotus aculeator (Masner), comb. nov. Holotype images in MBD: USNMENT01059225 Gryon aculeator Masner, 1983: 157 (original description); Johnson, 1992: 378 (cata- loged, type information). Hadronotus aculus (Mineo), comb. nov. Holotype images: https://zenodo.org/record/4498957#.YBsBDHIOlaQ Gryon aculum Mineo, 1991: 2 (original description, assigned to aculum species group). Hadronotus acuteangulatus (Mineo), comb. nov. Paratype images: https://zenodo.org/record/492489 1#.YMJ6knpKhaQ Gryon acuteangulatum Mineo, 1991: 3 (original description, assigned to acuteangula- tum species group). Comments. We transfer this species based the paratype specimen that we examined as well as characters and Figures 1a—b from the original description, “clava of six anten- nomeres... the sculpture of the head consists of irregular polygons.” Hadronotus acutiventris (Masner), comb. nov. Holotype images in MBD: CNC No. 17015 Gryon acutiventre Masner, 1983: 134, 158 (original description, keyed); Johnson, 1992: 378 (cataloged, type information). Hadronotus agamennone (Mineo), comb. nov. Paratype images: https://zenodo.org/record/4924896#. YMJ6vnpKhaQ, Gryon agamennone Mineo, 1992: 26 (original description) Comments. We transfer this species based on a paratype specimen and the original description, “...frontal depression that is striated for not more than 404 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) 7, the remaining being smooth and shiny,” and because it was considered by Mineo 1992 to be part of the oculatum species group. Hadronotus agilis Ashmead, comb. rev. Hadronotus agilis Ashmead, 1896: 799 (original description); Ashmead, 1900: 328 (distribution); Kieffer, 1926: 454, 466 (description, keyed). Gryon agilis (Ashmead): Masner, 1965: 74 (type information, generic transfer); Masner, 1976: 58 (description). Gryon agile (Ashmead): Johnson, 1992: 378 (cataloged, type information). Comments. We transfer this species back to Hadronotus based on the original descrip- tion of the sculpture as “coarsely rugose.” Hadronotus alames (Kozlov & Lé), comb. nov. Holotype images in MBD: IEBR 0160 Gryon alames Kozlov & Lé, 1992: 233, 237 (original description, assigned to muscae- forme species group, keyed); Kozlov & Lé, 1996: 12 (description); Lé, 2000: 100 (description, keyed, type information). Hadronotus allanidoddi (Mineo), comb. nov. Holotype images: https://zenodo.org/record/4498975#. YBsFBnlOlaQ. Plastogryon flavipes Dodd, 1914a: 125 (original description. Preoccupied by Telenom- oides flavipes Dodd (1913a)); Dodd, 1915: 25 (keyed). Plastogryon (Heterogryon) flavipes Dodd: Kieffer, 1926: 446, 451 (description, subge- neric assignment, keyed). Gryon flavipes (Dodd): Galloway, 1976: 91 (type information, generic transfer); John- son, 1992: 383 (cataloged, type information). Gryon allanidoddi Mineo: Mineo, 1990b: 55 (replacement name for Plastogryon flavipes Dodd, description). Hadronotus ambericus (Peter & Rajmohana), comb. nov. Gryon ambericum Peter & Rajmohana, 2014: 6711 (original description, diagnosis, placed in /eptocorisae species group). Comments. Our transfer of this species to Hadronotus is based on images provided in the original description. A maximalist approach to the systematics of Gryon aetherium 405 Hadronotus amerares (Kozlov & Lé), comb. nov. Holotype images in MBD: IEBR 0161 Gryon amerares Kozlov & Lé, 1992: 230, 237 (original description, assigned to muscae- forme species group, keyed). Gryon ameraris Kozlov & Lé, 1996: 11 (description); Lé, 2000: 99, 101 (description, keyed, type information). Hadronotus americanus (Mineo), comb. nov. Gryon americanum Mineo, Mineo & Caleca,1994: 130 (original description) Comments. We transfer this species based on the original description, “frontal depres- sion deep and large, crossed by dense and parallel transverse striae.” Hadronotus amissus (Kozlov & Kononova), comb. nov. Gryon amissus Kozlov & Kononova, 1989: 87 (original description, keyed); Kozlov & Kononova, 1989: 266, 276 (description, keyed). Gryon amissum Kozlov & Kononova: Kononova & Kozlov, 2008: 324, 351 (descrip- tion, keyed); Timokhov, 2019b: 47 (catalog of species of Russia). Comments. We transfer this species based on the original description, “Frontal depres- sion above antennae well pronounced, transversely striated.” Hadronotus amitto (Kozlov & Kononova), comb. nov. Gryon amitto Kozlov & Kononova, 1989: 87 (original description, keyed). Comments. We transfer this species based on the original description, “Frontal depres- sion above antennae well pronounced, transversely striated.” Hadronotus anasae (Ashmead), comb. rev. Holotype images in MBD: USNMENT00979994 Telenomus anasae Ashmead, 1887: 23 (original description). Hadronotus rugosus Howard, 1889: 242 (original description. Synonymized by Masner (1983)); Ashmead, 1893: 230, 232 (description, keyed); Brues, 1910: 47 (keyed); 406 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) Kieffer, 1926: 454, 463 (description, keyed); Masner, 1983: 139 (junior synonym of Gryon anasae (Ashmead)); Johnson, 1992: 378 (type information). Hadronotus anasae (Ashmead): Ashmead, 1893: 231, 233 (generic transfer, description, keyed); Brues, 1910: 47 (keyed); Brues, 1916: 555 (description); Kieffer, 1926: 454, 464 (description, keyed). Gryon anasae (Ashmead): Muesebeck & Masner, 1967: 299 (generic transfer); Masner & Muesebeck, 1968: 34 (lectotype designation); Masner, 1983: 134, 139 (descrip- tion, synonymy, keyed); Mineo & Caleca, 1987a: 32 (description); Johnson, 1992: 378 (cataloged, type information). Gryon rugosus (Howard): Muesebeck & Masner, 1967: 299 (generic transfer); Masner & Muesebeck, 1968: 36 (lectotype designation). Gryon rugosum (Howard): Mineo & Caleca, 1987a: 34 (description). Hadronotus ancinla (Kozlov & Lé), comb. nov. Holotype images: https://bdj.pensoft.net/article/47687/ Gryon ancinla Kozlov & Lé, 1992: 236, 238 (original description, assigned to muscae- forme species group, keyed); Kozlov & Lé, 1996: 11 (description); Lé, 2000: 98, 102 (description, keyed, type information). Gryon clavaerum Kozlov & Lé, 1992: 233, 237 (original description, assigned to mus- caeforme species group, keyed). Gryon clavaerus Kozlov & Lé, 1996: 12 (description); Lé, 2000: 99, 108 (description, keyed, type information); Chen et al., 2020: 12 (junior synonym of Gryon ancinla Kozlov & Lé) Hadronotus anserculus (Mineo), comb. nov. Figure 13; Holotype images: https://zenodo.org/record/4499013#.YBsHqHlOlaQ. Gryon anserculum Mineo, 1991: 7 (original description, assigned to aureum species group). Hadronotus apex (Kozlov & Kononova), comb. nov. Paratype images: https://zenodo.org/record/5603602#.YXlaE_nMJaQ. Gryon apex Kozlov & Kononova, 2004: 195 (original description); Kononova & Ko- zlov, 2008: 324, 358 (description, keyed). Hadronotus argus (Kononova), comb. nov. Gryon argus Kononova, 2005: 1353 (original description) A maximalist approach to the systematics of Gryon aetherium 407 Comments. From the original description, “The frontal indentation is superficial, not bordered by an arcuate keel, in transverse wrinkles, with a distinct longitudinal keel.” The summary of the original publication, written in English, states that “Gryon argus is similar to G. coronatum, Kononova, but differs in abdomen proportions.” Illustrations in the original description of G. coronotum depict a frontal depression that enables us to place that species in Hadronotus. It is on this basis and the presence of “transverse wrinkles” in the frontal depression that we make the generic transfer. Hadronotus artus (Kozlov & Kononova), comb. nov. Holotype images: https://zenodo.org/record/4531735#.YCQrVnlOlaQ Gryon artus Kozlov & Kononova, 1989; 81, 99 (original description); Kozlov & Kon- onova, 1990: 306 (description, keyed); Johnson, 1992: 379 (catalogued); Kon- onova & Kozlov, 2008: 333, 439 (description, keyed). Comments. Mirotelenomus artus Kozlov was transferred to Exon by Masner (1980) and to Gryon by Mineo (1980a). The description of Gryon artus Kozlov & Kononova thereby created a homonym, one that is resolved by our transfer of this species to Hadronotus. Hadronotus atrocoxalis Ashmead, comb. rev. Hadronotus atrocoxalis Ashmead, 1896: 799 (original description); Ashmead, 1900: 328 (distribution); Kieffer, 1926: 455, 466 (description, keyed). Gryon atrocoxalis (Ashmead): Masner, 1965: 74 (type information); Masner, 1976: 58 (description, systematic position); Masner, 1979: 792, 794 (description, keyed). Gryon atrocoxale (Ashmead): Johnson, 1992: 379 (cataloged, type information). Comments. The original description indicates that this species is rugose, and separately states “Abdomen rugose”, leading us to believe that the former refers to the head or mesosoma. Masner (1976) commented that it “runs to floridanus-Ashmead group yet of much finer sculpture” and Masner (1979) placed this species in the variicornis spe- cies group, which we consider to belong in Hadronotus. Hadronotus ater (Masner), comb. nov. Figure 11: Holotype images in MBD: CNC No. 17012 Gryon atrum Masner, 1983: 135, 139 (original description, keyed); Sarazin, 1986: 972 (type information); Johnson, 1992: 379 (cataloged, type information). 408 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) Hadronotus aureus (Dodd), comb. nov. Plastogryon aureus Dodd, 1914f: 256 (original description); Dodd, 1915: 24 (keyed). Plastogryon (Heterogryon) aureus Dodd: Kieffer, 1926: 447, 450 (description, subge- neric assignment, keyed). Gryon aureus (Dodd): Galloway, 1976: 91 (type information, generic transfer). Gryon aureum (Dodd): Mineo, 1991: 7 (assigned to aureum species group); Johnson, 1992: 379 (cataloged, type information). Comments. The original description is insufficient to determine if this species belongs in Gryon or Hadronotus. Mineo (1991) assigned Gryon aureum to an eponymous spe- cies group but without explicitly stating if the holotype specimen of Plastogryon aureus was examined. The characters in the description of the aureum species group indicate that it belongs in Hadronotus and it is on this basis that we transfer it. Hadronotus austini (Mineo), comb. nov. Paratype images: https://zenodo.org/record/4924904#.YMJ6wHpKhaQ Gryon austini Mineo, 1991: 6 (original description, assigned to acuteangulatum species group). Comments. The transfer to Hadronotus is based on examination of a paratype speci- men and characters in the original description: mandibles tridentate, striae present above the frontal depression, and frons sculptured with irregular polygons. Hadronotus australicus (Mineo), comb. nov. Holotype images: https://zenodo.org/record/4723897#.YIhY__IKhaQ Sparasion nigricoxa Dodd, 1914a: 123 (original description. Preoccupied by Gryon ni- gricoxa (Dodd) (1913a)). Austroscelio nigricoxa (Dodd): Dodd, 1914c: 93 (description, generic transfer, synon- ymy); Kieffer, 1926: 473 (description, keyed); Galloway, 1976: 85 (type informa- tion). Sparaison australicum Dodd, 1914f: 255 (original description, spelling error. Syn- onymized by Dodd (1914c)); Johnson, 1992: 391 (type information). Sparasion australicum Dodd: Dodd, 1914c: 93 (junior synonym of Austroscelio nigri- coxa (Dodd)). Sparasion australicus Dodd: Kieffer, 1926: 299 (description, emendation). Austroscelio australicum (Dodd): Galloway, 1976: 85 (type information). Gryon nigricoxa (Dodd): Galloway & Austin, 1984: 80 (generic transfer); Johnson, 1992: 391 (cataloged, type information). A maximalist approach to the systematics of Gryon aetherium 409 Gryon australicum Mineo: Mineo, 1990b: 52 (replacement name for Sparasion nigri- coxa Dodd, assigned to insulare species group, type information). Hadronotus avanus (Kozlov & Lé), comb. nov. Paratype Images in MBD: USNMENT01223638 Gryon avanum Kozlov & Lé, 1992: 231, 237 (original description, assigned to muscae- forme species group, keyed). Gryon avanus Kozlov & Lé, 1996: 12 (description); Lé, 2000: 99, 103 (description, keyed, type information). Hadronotus baeiformis (Marshall), comb. rev. Prosacantha baeiformis Marshall, 1892: 75 (original description). Hoplogryon (Hoplogryon) baeiformis (Marshall): Kieffer, 1910: 96 (generic transfer, sub- generic assignment). Hadronotus baeiformis (Marshall): Kieffer, 1926: 455, 468 (generic transfer, descrip- tion, keyed). Gryon baeiforme (Marshall): Johnson, 1992: 379 (cataloged). Comments. The original description states that the head is “partout fortement ponc- tuée” which translates to “strongly punctuated everywhere” and is the basis for transfer- gly p yw. ring this species to Hadronotus. Hadronotus barbiellinii Costa Lima, comb. rev. Hadronotus Barbiellinii Costa Lima, 1940: 65 (original description). Gryon barbiellinii (Costa Lima): De Santis, 1980: 312 (generic transfer); Johnson, 1992: 379 (cataloged, type information). Comments. This species is returned to Hadronotus based on characters in the original description, “Face (frontal space located above the base of the antennae and inside the curved protruding line that separates it from the forehead) presenting, in the middle, deep longitudinal groove, transversely striated, at the sides of which there is an oblique series of 4 to 5 relatively wide areolas, immediately into the small areolas that border the edge of the eye and out of another series of areolas, much smaller, which are parallel to it.” Hadronotus basokoi Risbec, comb. rev. Hadronotus basokoi Risbec, 1958: 115 (original description). 410 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) Gryon basokoi (Risbec): Masner, 1976: 58 (generic transfer, systematic position); John- son, 1992: 379 (cataloged, type information). Comments. From the original description, “Quite deep postantennal depressions, clear- ly limited by two ridges which meet at a sharp angle. Crossed by fairly strong streaks.” Hadronotus bicolor Ashmead, comb. rev. Figures 88-91; Holotype images in MBD: USNMENT01109345 Hadronotus bicolor Ashmead, 1894: 229, 231 (original description, keyed); Ashmead, 1900: 328 (distribution); Kieffer, 1926: 455, 468 (description, keyed). Gryon bicolor (Ashmead): Masner, 1976: 58 (generic transfer, taxonomic status); Mi- neo, 1980a: 190 (removed from synonymy with Gryon misellum Haliday); John- son, 1992: 379 (cataloged). Hadronotus bimaculatus (Mineo), comb. nov. Holotype images: https://zenodo.org/record/4499037#.YBsNC31OlaQ Gryon bimaculatum Mineo, 1983c: 546, 551 (original description); Johnson, 1992: 380 (cataloged, type information). Hadronotus bini (Mineo), comb. nov. Holotype images: https://zenodo.org/record/4499039#. YBsOi3lOlaQ Gryon bini Mineo, 1983c: 528, 546 (original description); Johnson, 1992: 380 (cataloged). Hadronotus blaches (Kozlov & Lé), comb. nov. Holotype images in MBD: IEBR 0048 Gryon blaches Kozlov & Lé, 1992: 225, 227 (original description, assigned to insulare species group, keyed). Gryon blachis Kozlov & Lé, 1996: 10 (description); Lé, 2000: 98, 104 (description, keyed, type information). Hadronotus bolivari Giard, comb. rev. Hadronotus Bolivari Giard, 1895: 78 (original description. Type lost from MNHN); Kieffer, 1913: 244 (description). A maximalist approach to the systematics of Gryon aetherium 411 Hadronotus Proximus Kieffer, 1913: 244 (original description); Johnson, 1992: 380 (type information). Hadronotus bolivari Giard: Kieffer, 1926: 454, 458 (description, keyed); Szabd, 1966: 430, 433 (description, keyed). Hadronotus proximus Kieffer: Kieffer, 1926: 454, 459 (description, keyed); Bin, 1974: 455 (type misssing from MCSN); Mineo, 1979a: 237 (lectotype designation). Hadronotus ochraceus Szabé, 1966: 429, 431 (original description); Mineo, 1979a: 237 (junior synonym of Hadronotus Bolivari Giard); Johnson, 1992: 380 (type information). Gryon proximus (Kieffer): Kozlov, 1978: 620 (description); Kozlov & Kononova, 1989: 79 (keyed); Kozlov & Kononova, 1990: 267, 280 (description, keyed); Kononova & Petrov, 2002: 54 (keyed). Gryon bolivari (Giard): Mineo, 1979: 237 (description, generic transfer); Mineo, 1981: 119, 120 (description, type information, keyed); Johnson, 1992: 380 (cataloged, type information); Mineo & Caleca, 1994: 117 (distribution, as- signed to muscaeforme subgroup of muscaeforme group); Kononova & Kozloy, 2008: 325, 362 (description, keyed); Timokhov, 2019b: 47 (catalog of species of Russia). Comments. We return this species to Hadronotus based on a character in the original description, “head black, punctate.” Hadronotus bosellii (Mineo & Szab6), comb. nov. Holotype images: https://zenodo.org/record/4499042#.YBsQeXlOlaQ Gryon bosellii Mineo & Szabé, 1978b: 113 (original description); Mineo, 1981a: 119, 124 (diagnosis, keyed); Johnson, 1992: 380 (cataloged, type information); Mineo & Caleca, 1994: 117 (distribution, assigned to muscaeforme subgroup of muscae- forme group); Kononova & Petrov, 2002: 54 (keyed); Kononova & Kozlov, 2008: 325, 367 (description, keyed). Hadronotus brasiliensis Costa Lima, comb. rev. Hadronotus brasiliensis Costa Lima, 1928: 1 (original description). Gryon brasiliensis (Costa Lima): De Santis, 1980: 312 (generic transfer). Gryon brasiliense (Costa Lima): Johnson, 1992: 380 (cataloged, type information). Comments. We transfer this species back to Hadronotus based on characters in the original description, “antennal suture or pit distinctly separated from the forehead by an arched cross-striated trench, leading the most saline striae of the midline to the areolas of the face.” 412 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) Hadronotus cabrucae (Mineo), comb. nov. Holotype images: https://zenodo.org/record/4499046#. YBsRxXlOlaQ Gryon cabrucae Mineo, Mineo & Caleca, 1994: 126 (original description, assigned to floridanum group). Hadronotus canus (Mineo), comb. nov. Figure 14; Holotype images: https://zenodo.org/record/4499060#. YBsUrnlOlaQ. Gryon canum Mineo, 1991: 15 (original description, assigned to /eptocorisae species group); Mineo & Caleca, 1994: 122 (distribution). Hadronotus carinatifrons Ashmead, comb. rev. Holotype images: https://zenodo.org/record/4499077#.YBscUn|IOlaQ Hadronotus carinatifrons Ashmead, 1894: 229, 230 (original description); Ashmead, 1900: 328 (distribution); Brues, 1910: 47 (keyed); Kieffer, 1926:455, 467 (description, keyed). Gryon carinatifrons (Ashmead): Muesebeck & Masner, 1967: 299 (generic transfer); Alayo Dalmau, 1973: 99 (cataloged); Masner, 1983: 134, 143 (type information, spelling error); Mineo & Caleca, 1987a: 32 (description, keyed); Johnson, 1992: 380 (cataloged, type information). Gryon carinatiforns (Ashmead): Masner, 1976: 58 (type information, spelling error). Hadronotus charon Nixon, comb. rev. Holotype images: https://zenodo.org/record/4499096#.YBsb6X1OlaQ Hadronotus charon Nixon: Nixon, 1934b: 292, 306 (description); Risbec, 1950: 592, 595 (original description). Gryon charon (Nixon): Masner, 1965: 75 (type information); Mineo, 1982b: 312 (de- scription); Mineo, 1983a: 18 (description, variation, keyed); Johnson, 1992: 380 (cataloged, type information). Hadronotus chelinideae (Masner), comb. nov. Holotype images in MBD: USNMENT01059234 Gryon chelinideae Masner, 1983: 133, 159 (original description, keyed); Johnson, 1992: 381 (cataloged, type information). Hadronotus chinchillae (Caleca), comb. nov. Holotype images: https://zenodo.org/record/4499 104#. YBsfwXlOlaQ. A maximalist approach to the systematics of Gryon aetherium 413 Gryon chinchillae Caleca, 1990a: 119, 120 (original description, keyed). Hadronotus circus (Kozlov & Lé), comb. nov. Paratype images in MDB: USNMENT01223669 Gryon circum Kozlov & Lé, 1992: 223, 227 (original description, assigned to insulare species group, keyed). Gryon circus Kozlov & Lé, 1996: 10 (description); Lé, 2000: 97, 107 (description, keyed, type information). Comments. The frons of this species suggests close relation to H. watshami. Hadronotus clavigrallae (Mineo), comb. nov. Holotype images: https://zenodo.org/record/4499 107#. YBshQHIOlaQ. Gryon clavigrallae Mineo, Mineo & Caleca, 1994: 116 (original description, assigned to fulviventre subgroup of muscaeforme group). Hadronotus compoventris (Kozlov & Lé), comb. nov. Holotype images in MBD: IEBR 0163 Gryon compoventre Kozlov & Lé, 1992: (original description, assigned to muscaeforme species group, keyed). Gryon compoventris Kozlov & Lé, 1996: 11 (description); Lé, 2000: 99, 110 (descrip- tion, keyed, type information). Hadronotus coronatus (Kononova), comb. nov. Gryon coronatum Kononova, 2008: 322, 335 (original description, keyed); Timokhoy, 2019b: 47 (catalog of species of Russia). Comments. In the original description, figure 176 illustrates transverse striation across the frontal depression and a female antenna with five clavomeres. Hadronotus cous Nixon, comb. rev. Hadronotus cous Nixon, 1934b: 292, 301 (original description, keyed); Risbec, 1950: 592 (keyed). Gryon cous (Nixon): Masner, 1965: 75 (type information). 414 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) Gryon coum (Nixon): Mineo, 1983c: 528, 546 (description, keyed); Johnson, 1992: 381 (cataloged, type information). Comments. The original description provides characters that enable us to transfer this species to Hadronotus, including “Frons with a deep, well-defined impression which is completely margined.” Hadronotus chromion (Kozlov & Lé), comb. nov. Holotype images in MBD: IEBR 0175 Gryon chromion Kozlov & Lé, 1992: 232, 237 (original description, assigned to mus- caeforme species group, keyed). Gryon cromion Kozlov & Lé, 1996: 12 (description, misspelling); Lé, 2000: 100, 112 (description, keyed, type information). Hadronotus cultratus (Masner), comb. nov. Paratype images: https://zenodo.org/record/4959367#.YNnSfklKhaQ Gryon cultratus Masner, 1979: 794, 799 (original description, keyed); Sarazin, 1986: 974 (type information). Gryon cultratum Masner: Johnson, 1992: 381 (cataloged, type information). Comments. This species is transferred to Hadronotus based on its placement in the variicorne group and characters presented in the original description: “head... with D> coarse transverse polygons’, “scutellum with polygons roughly rounded” and examina- tion of a paratype specimen. Hadronotus dasyni Nixon, comb. rev. Hadronotus dasyni Nixon, 1934a: 2 (original description, keyed). Gryon dasyni (Nixon): Masner, 1965: 75 (type information); Mineo, 1990: 90 (keyed); Johnson, 1992: 381 (cataloged, type information). Comments. The original description and (Figure 1) in Nixon (1934) list and illustrate a form of the frontal depression that clearly places this species in Hadronotus, “Frontal impression completely margined by a sharply defined ridge.” Hadronotus david (Masner), comb. nov. Holotype images: https://cnc.agr.gc.ca/taxonomy/Specimen.php?id=2952 A maximalist approach to the systematics of Gryon aetherium 415 Gryon david Masner, 1979: 793, 798 (original description, keyed); Sarazin, 1986: 974 (type information); Johnson, 1992: 381 (cataloged, type information). Hadronotus dessarti (Mineo), comb. nov. Holotype images: https://zenodo.org/record/4502725#.YBw9tXlOlaQ Gryon dessarti Mineo, 1991: 38 (original description, assigned to oculatum species group). Hadronotus diadematis (Mineo), comb. nov. Paratype images: https://zenodo.org/record/4959399#.YNnSTklKhaQ Gryon diadematis Mineo, 1983a: 18, 19 (original description, keyed); Johnson, 1992: 381 (cataloged, type information). Comments. We transfer this species to Hadronotus based on the description of the “completely enframed frontal depression... connected to the anterior ocellus by a ridge” provided in Mineo (1983a) and examination of a paratype specimen. Hadronotus dichromos (Galloway), comb. nov. Holotype images: https://zenodo.org/record/4503990#.YBxeBnlOlaQ Plastogryon bicolor Dodd, 1913b: 171 (original description. Preoccupied by Hadronotus bicolor Ashmead (1894)); Dodd, 1915: 24 (keyed). Plastogryon (Heterogryon) bicolor (Dodd): Kieffer, 1926: 447, 451 (description, subge- neric assignment, keyed). Gryon bicolor (Dodd): Galloway, 1976: 91 (type information, generic transfer). Gryon dichromos Galloway: Galloway & Austin, 1984: 79 (replacement name); Mi- neo, 1990a: 186 (description of male); Mineo, 1991: 7 (assigned to charon species group); Johnson, 1992: 381 (cataloged, type information). Hadronotus discolor (Mineo & Szabé), comb. nov. Holotype images: https://zenodo.org/record/4504025#.YBxe8XlOlaQ Gryon discolor Mineo & Szabé, 1978c: 94 (original description); Johnson, 1992: 382 (cataloged, type information). Hadronotus drunores (Kozlov & Lé), comb. nov. Holotype images in MBD: IEBR 0176 416 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) Gryon drunores Kozlov & Lé, 1992: 235 (original description, assigned to muscaeforme species group). Gryon drumores Kozlov & Lé, 1992: 237 (keyed, misspelling). Gryon drunoris Kozlov & Lé, 1996: 11 (description); Lé, 2000: 98, 113 (description, keyed, type information). Hadronotus dubius (Kozlov & Kononova), comb. nov. Holotype images: https://zenodo.org/record/4726076#.YXIbFPnMJaQ Paratype images: https://zenodo.org/record/5603654#.YXlbpPnMJaQ Gryon dubium Kozlov & Kononova, 2004: 199 (original description); Kononova & Kozlov, 2008: 322, 333 (description, keyed); Timokhov, 2019a: 19 (distribution); Timokhov, 2019b: 47 (catalog of species of Russia). Hadronotus elegans (Dodd), comb. nov. Plastogryon elegans Dodd, 1914c: 94 (original description); Galloway, 1976: 111 (type information, status uncertain). Plastogryon (Heterogryon) elegans Dodd: Kieffer, 1926: 447, 451 (description, subge- neric assignment, keyed). Gryon elegans (Dodd): Mineo, 1990a: 185 (generic transfer, type information); Mineo, 1991: 7 (assigned to aureum species group); Johnson, 1992: 382 (cataloged, type information). Comments. Mineo (1990a) stated that he found and examined the holotype specimen of Plastogryon elegans in the South Australia Museum. Mineo (1991) placed this species in the aureum species group, which he described as having “mandibles subtridentate” and “frontal depression large but moderately deep, crossed by very fine and dense striae.” This forms our basis for transferring this species to Hadronotus. Hadronotus elongatus Risbec, comb. rev. Lectotype images: https://zenodo.org/record/4504271#.YBxm4nlOlaQ Hadronotus antestiae var. elongatus Risbec, 1950: 597 (original description); Mineo, 1990b: 50 (lectotype designation, synonymy); Johnson, 1992: 383 (type information). Gryon antestiae var. elongatus (Risbec): Masner, 1976: 58 (generic transfer, type infor- mation). Gryon risbeci Mineo, 1990b: 50 (original description, assigned to Aiberus species group, a junior objective synonym of Hadronotus antestiae var. elongatus Risbec). A maximalist approach to the systematics of Gryon aetherium 417 Hadronotus euclidis (Mineo), comb. nov. Holotype images: https://zenodo.org/record/4504306#. YBxoRXlOlaQ. Gryon euclide Mineo, 1992: 21 (original description). Hadronotus eugeniae (Risbec), comb. nov. Holotype images: https://zenodo.org/record/4504356#.YBxpenlOlaQ Microphanurus eugeniae Risbec, 1953: 326 (original description). Gryon eugeniae (Risbec): Masner, 1976: 58 (generic transfer, type information); John- son, 1992: 382 (cataloged, type information). Hadronotus eurystenis (Mineo), comb. nov. Paratype images: https://zenodo.org/record/5104412#.YO9CaEIKhaR Gryon eurystene Mineo, 1992: 21 (original description) Comments. Our transfer of this species to Hadronotus is based on the original descrip- tion, which states that this species is “Closely related to G. canum” and examination of a paratype specimen Hadronotus exsculptus Forster, comb. rev. Figures 92-94; Holotype images: https://zenodo.org/record/4504407#. YBxrf3lOlaQ Hadronotus exsculptus Forster, 1861: 41 (original description); Dalla Torre, 1885: 76 (reprint of Forster (1861)); Kieffer, 1908: 145 (French translation of Forster (1861)); Kieffer, 1926: 453, 458 (description, keyed). Hadronotus Exsculptus Forster: Kieffer, 1913: 238 (description). Gryon exsculptus (Forster): Kozlov, 1978: 620 (description); Mineo, 1979a: 244 (de- scription); Kozlov & Kononova, 1989: 78 (keyed). Gryon exsculptum (Forster): Mineo, 1981a: 119, 126 (description of male, diagnosis, keyed); Johnson, 1992: 382 (cataloged, type information); Kononova & Kozlov, 2008: 325, 364 (description, keyed); Timokhov, 2019b: 47 (catalog of species of Russia). Gryon exculptus (Forster): Kozlov & Kononova, 1990: 266, 272 (description, keyed, error); Kononova, 1995: 81 (keyed); Kononova & Petrov, 2002: 54 (keyed). Gryon exculptum (Forster): Mineo & Caleca, 1994: 117 (spelling error, distribution, assigned to muscaeforme subgroup of muscaeforme group). 418 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) Hadronotus fervidus (Mineo), comb. nov. Paratype images: https://zenodo.org/record/5018387#.YNnQwklKhaQ Gryon fervidum Mineo, 1992: 18 (original description). Comments. ‘The original description is brief, and characters needed to properly place this species are largely absent. We interpret “from upper margin of the frontal depres- sion and because there is no ridge connecting the latter to anterior ocellus” to refer to a carinate margin of the frontal depression, as is seen in Hadronotus ancinla (Chen et al. 2020), and which may be connected to the anterior ocellus by a carina. Mineo (1992) placed G. fervidum in the hiberus group, but the description of the Aiberus group by Mi- neo (1990b) is also brief and insufficient for generic placement. We examined the holo- type of Hadronotus lucmon, described as Gryon lucmon concomitantly with G. fervidum, which was also placed in the Aiberus group and which belongs in Hadronotus. Our ex- amination of a paratype specimen also supports placement of this species in Hadronotus. Hadronotus flavios (Dodd), comb. nov. Holotype images: https://zenodo.org/record/4504474#.YBxtSHIOlaQ Plastogryon flavios Dodd, 1915: 32 (original description). Gryon flavios (Dodd): Galloway, 1976: 91 (type information, generic transfer); Mineo, 1991: 7 (assigned to charon species group); Johnson, 1992: 382 (cataloged, type information). Hadronotus flavipes Ashmead, comb. rev. Holotype images in MBD: USNMENT00989868 Hadronotus flavipes Ashmead, 1905: 399 (original description. Preoccupied by Gryon flavipes Ashmead (1893). Synonymized with Telenomus orestes Dodd by Mineo (1990a)); Kieffer, 1926: 454, 460 (description, keyed); Baltazar, 1966: 182 (cat- aloged, type information, distribution); Mineo, 1990a: 178 (junior synonym of Gryon orestes (Dodd)); Johnson, 1992: 392 (type information). Plastogryon fuscus Dodd, 1915: 25, 26 (original description, keyed. Synonymized with Telenomus orestes Dodd by Mineo (1990a)); Mineo, 1990a: 178 (junior synonym of Gryon orestes (Dodd)); Johnson, 1992: 392 (type information). Telenomus orestes Dodd, 1913a: 167, 168 (original description, keyed). Liophanurus orestes (Dodd): Kieffer, 1926: 68, 90 (description, generic transfer, keyed). Hadronotus leptocorisae Nixon, 1934: 2,5 (original description, keyed. Preoccupied by Had- ronotus leptocorisae Howard (1885). Synonymized with Hadronotus flavipes Ashmead by Mineo (1979)); Mineo, 1979: 247 (junior synonym of Hadronotus flavipes Ashmead); Mineo, 1990: 178 (incorrect placement); Johnson, 1992: 393 (type information). Gryon nixoni Masner: Masner, 1965: 77 (replacement name for Hadronotus leptocorisae Nixon, type information, synonymized with Hadronotus flavipes Ashmead by Mineo A maximalist approach to the systematics of Gryon aetherium 419 (1979)); Mineo, 1979: 247 (junior synonym of Hadronotus flavipes Ashmead); Mi- neo, 1981: 119, 139 (description, keyed); Mineo, 1990: 178 (incorrect placement). Gryon ferus Masner & Muesebeck: Masner & Muesebeck, 1968: 35 (replacement name for Hadronotus flavipes Ashmead. Type information. Synonymized with Téelenomus orestes Dodd by Mineo (1990a)); Mineo, 1990a: 179 (junior synonym of Gryon orestes (Dodd)). Gryon fuscus (Dodd): Galloway, 1976: 91 (type information, generic transfer). Gryon orestes (Dodd): Johnson, 1988b: 242 (type information, generic transfer); Mi- neo, 1990a: 178 (synonymy, variation); Johnson, 1992: 392 (cataloged, type infor- mation); Kononova & Kozlov, 2008: 324, 356 (description, keyed). Hadronotus floridanus Ashmead, comb. rev. Lectotype images in MBD: USNMENT00989854 Hadronotus floridanus Ashmead, 1887: 118 (original description); Ashmead, 1893: 231, 232 (description, keyed); Brues, 1910: 47 (keyed); Kieffer, 1926: 454, 463 (description, keyed). Hadronotus robustus Brues, 1907: 156 (original description. Synonymized by Masner (1983)); Brues, 1910: 46, 47 (diagnosis of male, keyed); Kieffer, 1926: 454, 464 (description, keyed); Masner, 1983: 136 (junior synonym of Gryon floridanum (Ashmead)); Johnson, 1992: 383 (type information). Gryon robustus (Brues): Masner, 1965: 299 (type information, generic transfer). Gryon floridanus (Ashmead): Muesebeck & Masner, 1967: 299 (generic transfer); Mas- ner & Muesebeck, 1968: 35 (lectotype designation). Gryon floridanum (Ashmead): Masner, 1983: 135, 136 (description, synonymy, emen- dation, keyed); Mineo & Caleca, 1987: 32 (description); Johnson, 1992: 383 (cat- aloged, type information). Hadronotus fulvicoxus (Komeda & Mita), comb. nov. Gryon fulvicoxa Komeda & Mita, in Komeda, Mita, Hirose & Yamagishi, 2020: 101, 128 (original description, keyed). Comments. The transfer to Hadronotus is based on images and characters in the origi- nal description. Hadronotus fulviventris Crawford, comb. rev. Holotype images in MBD: USNMENT00989855 Hadronotus fulviventris Crawford, 1912: 2 (original description). Hadronotus antestiae Dodd, 1920a: 351 (original description. Synonymized by Mineo (1979a)); Nixon, 1934b: 292, 306 (emendation of original description, keyed); 420 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) Risbec, 1950: 592 (keyed); Mineo, 1979a: 247 (junior synonym of Gryon fulviven- tris (Crawford)); Johnson, 1992: 383 (type information). Gryon antestiae (Dodd): Masner, 1965: 74 (lectotype designation). Gryon fulviventris (Crawford): Masner & Muesebeck, 1968: 35 (type information, ge- neric transfer); Mineo, 1979a: 247 (synonymy); Mineo, 1981a: 119, 128 (diag- nosis, keyed); Sharma, 1982: 336 (keyed); Lé, 2000: 98, 115 (description, keyed). Gryon terraesanctae Mineo & Szabé, 1978b: 116 (original description. Synonymized by Mineo (1979a)); Mineo, 1979a: 247 (junior synonym of Gryon fulviventris (Craw- ford)); Johnson, 1992: 383 (type information). Gryon tico Mineo & Szabd, 1978c: 96 (original description. Synonymized by Mineo (1990a)); Mineo, 1990a: 174 (junior synonym of Gryon fulviventre (Crawford)); Johnson, 1992: 383 (type information). Gryon fulviventre (Crawford): Mineo, 1990a: 174 (emendation, variation); Johnson, 1992: 383 (cataloged, type information); Kononova & Kozlov, 2008: 322, 343 (description, keyed); Rajmohana, 2014: 34 (description, distribution). Hadronotus gallardoi (Bréthes), comb. nov. Notilena Gallardoi Brethes, 1913: 85 (original description). Gryon gallardoi (Bréthes): De Santis & Esquivel, 1966: 50 (generic transfer); Loiaco- no, 1980: 173 (description); Mineo & Caleca, 1987a: 37 (description); Johnson, 1992: 383 (cataloged, type information). Comments. We transfer this species to Hadronotus based on characters in the origi- nal description, “Head punctate-umbilicate, face longitudinally impressed, crested on both sides, transverse striae and in the midst of the antennae longitudinally crested.” Hadronotus geminus (Mineo), comb. nov. Gryon geminum Mineo, 1991: 6 (original description, assigned to acuteangulatum spe- cies group). Comments. The original description of G. geminum is so sparse that it can hardly be consid- ered a description. It merely states that this species differs from G. austini by the sculpture of the frons, but with no mention of how it is different. This approach to species descriptions is of no benefit and has created significant obstacles for advancing taxonomy in this group. Hadronotus giganteus (Mineo), comb. nov. Holotype images: https://zenodo.org/record/4504654#. YBxzznlOlaQ. A maximalist approach to the systematics of Gryon aetherium 421 Gryon giganteum Mineo, 1983c: 529, 546 (original description, keyed); Johnson, 1992: 384 (cataloged, type information). Hadronotus gnidus Nixon, comb. rev. Paratype images: https://zenodo.org/record/4730565#. YIwZxLVKhaQ Hadronotus gnidus Nixon, 1934b: 292, 305 (original description, keyed. Synonymized by Mineo (1990a)); Risbec, 1950: 592, 595 (variation, keyed); Mineo, 1990a: 174 (junior synonym of Gryon fulviventre (Crawford)). Gryon gnidum (Nixon): Mineo & Caleca, 1994: 117 (treated as valid species, distribu- tion, assigned to fulviventre subgroup of muscaeforme group). Comments. The original description compares this species to H. antestiae (jun- ior synonym of H. fulviventris), and we confirm that H. fulviventris belongs in Hadronotus based on examination of the holotype. We also examined two paratypes of H. gnidus, one male and one female. Hadronotus goliath (Masner), comb. nov. Holotype images: https://cnc.agr.gc.ca/taxonomy/Specimen.php?id=2953 Gryon goliath Masner, 1979: 793, 798 (original description, keyed); Sarazin, 1986: 974 (type information); Johnson, 1992: 384 (cataloged, type information). Hadronotus grenadensis Ashmead, comb. rev. Hadronotus grenadensis Ashmead, 1896: 800 (original description); Ashmead, 1900: 328 (distribution); Kieffer, 1926: 454, 466 (description, keyed). Gryon grenadensis (Ashmead): Masner, 1965: 76 (type information, generic transfer); Masner, 1976: 58 (description, systematic position). Gryon grenadense (Ashmead): Johnson, 1992: 384 (cataloged, type information). Comments. We transfer this species based on characters in the original description, “Facial impression transversely striated, margined.” Hadronotus hectoris (Mineo), comb. nov. Gryon hectore Mineo, 1992: 25 (original description). 422 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) Comments. We transfer this species to Hadronotus based on characters presented in P Pp the original description, “frontal depression that is moderately large and deep, finely enframed and densely striated.” Hadronotus helavai (Masner), comb. nov. Holotype images: https://cnc.agr.gc.ca/taxonomy/Specimen.php?id=2954 Gryon helavai Masner, 1979: 793, 797 (original description, keyed); Sarazin, 1986: 974 (type information); Johnson, 1992: 384 (cataloged, type information). Hadronotus hercules (Masner), comb. nov. Holotype images: https://cnc.agr.gc.ca/taxonomy/Specimen.php?id=2955 Gryon hercules Masner, 1979: 793, 801 (original description, keyed); Sarazin, 1986: 974 (type information); Johnson, 1992: 384 (cataloged, type information). Hadronotus hiberus Nixon, comb. rev. Hadronotus hiberus Nixon, 1934b: 292, 299 (original description, keyed); Risbec, 1950: 592 (keyed). Gryon hiberus (Nixon): Masner, 1965: 76 (type information, generic transfer); Mineo, 1990b: 49 (description, assigned to Aiberus species group); Johnson, 1992: 384 (cataloged, type information). Comments. We transfer this species to Hadronotus based on characters from the origi- nal description, “Frons with a fairly deep, more or less oval impression which is sharply and completely margined.” Hadronotus hidakae (Mineo), comb. nov. Gryon hidakae Mineo, 1980b: 218, 220 (original description, keyed); Johnson, 1992: 384 (cataloged, type information); Kononova & Petrov, 2002: 56 (keyed); Kon- onova & Kozlov, 2008: 331, 420 (description, keyed). Comments. We transfer this species based on the sculpturing of the frontal depression, illustrated in Figure II-1 in the original description. A maximalist approach to the systematics of Gryon aetherium 423 Hadronotus hilaris (Mineo), comb. nov. Holotype images: https://zenodo.org/record/4505098#.YByOT31OlaQ Gryon hilare Mineo, Mineo & Caleca, 1994: 115 (original description, assigned to aureum group). Hadronotus hirsutioculus Girault, comb. rev. Hadronotus hirsutioculus Girault, 1925: 183 (original description). Gryon hirsutioculus (Girault): Galloway, 1976: 91 (type information, generic transfer). Gryon hirsutioculum (Girault): Mineo, 1990a: 186 (emendation, type information, sys- tematic position); Johnson, 1992: 384 (cataloged, type information); Mineo & Caleca, 1994: 114 (assigned to Airsutioculum group). Gryon hyrsutioculum (Girault): Mineo, 1991: 39 (description, misspelling). Comments. We transfer this species back to Hadronotus based on charac- ters in the original description, “face bounded by an arched carina above” and “vertex is also more rudely punctured.” Hadronotus histricus (Mineo), comb. nov. Holotype images: https://zenodo.org/record/4505129#.YByPoXlOlaQ Gryon histricum Mineo, 1991: 7 (original description, assigned to aureum species group). Hadronotus hogenakalensis (Sharma), comb. nov. Figure 10; Holotype images in MBD: USNMENT01197123 Gryon hogenakalensis Sharma, 1982: 329, 336 (original description, keyed); Lé, 1997: 23 (keyed); Lé, 2000: 99, 118 (description, keyed, type information). Gryon hogenakalense Sharma: Johnson, 1992: 384 (cataloged). Hadronotus hystericus (Mineo), comb. nov. Holotype images: https://zenodo.org/record/4505269#.YBySF31OlaQ Gryon hystericum Mineo, 1991: 16 (original description, assigned to /eptocorisae species group). 424 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) Hadronotus ialokombae (Mineo), comb. nov. Holotype images: https://zenodo.org/record/4505332#.YBy TGHIOlaQ Gryon ialokombae Mineo, 1983c: 547, 551 (original description, keyed); Mineo, 1990a: 181 (description); Johnson, 1992: 385 (cataloged, type information). Hadronotus iammancoi (Mineo), comb. nov. Holotype images: https://zenodo.org/record/4505360#. YBy I-31OlaQ. Gryon iammancoi Mineo, 1983s: 530, 546 (original description, keyed); Johnson, 1992: 385 (cataloged); Kononova & Kozlov, 2008: 329, 403 (description, keyed). Hadronotus iasonis (Mineo), comb. nov. Paratype images: https://zenodo.org/record/5018397#.YNnQpEIKhaQ, Gryon iasone Mineo, 1992: 21 (original description). Comments. The original description is brief and does little to place this species. How- ever, Mineo (1992) placed in the /eptocorisae species group, which leads us to transfer it to Hadronotus, and the paratype specimen we examined belongs in Hadronotus. Hadronotus indicus (Subba Rao & Chacko), comb. nov. Hadrophanurus indicus Subba Rao & Chacko, 1962: 478-479 (original description, keyed) Gryon indicum (Subba Rao & Chacko): Johnson, 1992: 385 (cataloged, type information). Comments. We transfer this species based on characters from the original description, “frons with a shallow depression having transverse striations and a small keel between the base of the antennae.” Hadronotus ingens (Veenakumari & Rajmohana), comb. nov. Gryon ingens Veenakumari & Rajmohana, 2016: 44 (original description). Comments. The transfer to Hadronotus is based on characters and figures in the origi- nal description. Hadronotus insularis Ashmead, comb. rev. Lectotype images in MBD: USNMENT01335839 A maximalist approach to the systematics of Gryon aetherium 425 Hadronotus insularis Ashmead, 1894: 229, 230 (original description, keyed); Ashmead, 1900: 328 (distribution); Kieffer, 1926: 454, 465 (description, keyed). Gryon insularis (Ashmead): Masner, 1975: 212 (keyed); Masner, 1976: 58 (type infor- mation, description); Mineo, 1979a: 251 (description); Mineo, 1980a: 197 (junior synonym of Gryon leptocorisae (Howard)). Gryon insulare (Ashmead): Masner, 1983: 134, 161 (description, emendation, keyed); Johnson, 1992: 385 (cataloged, type information). Lectotype designation. We here designated specimen USNMENT01338539 as the lectotype of this species. Hadronotus introversus (Mineo), comb. nov. Gryon introversum Mineo, 1991: 14 (original description, assigned to introversum spe- cies group). Comments. We transfer this species based on characters in the original description, “mandibles with 3 subequal teeth” and “epomia... complete”, and images of the head provided in Figure IV. Hadronotus janus Nixon, comb. rev. Hadronotus janus Nixon, 1934b: 292, 304 (original description, keyed); Risbec, 1950: 592 (keyed). Gryon janus (Nixon): Masner, 1965: 76 (type information, generic transfer); Masner, 1976: 58 (taxonomicstatus); Mineo, 1983c:532, 546 (description, keyed); Johnson, 1992:385 (cataloged, type information); Kononova & Kozlov, 2008: 331,422 (description, keyed). Comments. We transfer this species back to Hadronotus based on the original descrip- tion, “A species closely related to H. cous” and “Mesonotum...quite strongly rugose.” Hadronotus japonicus Ashmead, comb. rev. Holotype images in MBD: USNMENT00989857 Hadronotus japonicus Ashmead, 1904c: 74 (original description); Kieffer, 1926: 453, 460 (description, keyed). Gryon japonicus (Ashmead): Masner & Muesebeck, 1968: 35 (type information, ge- neric transfer); Mineo, 1979a: 252 (description). Gryon japonicum (Ashmead): Mineo, 1981a: 119, 130 (description of male, emenda- tion, keyed); Johnson, 1992: 385 (cataloged, type information); Lé, 2000: 99, 119 (description, keyed); Kononova & Kozlov, 2008: 331, 421 (description, keyed). 426 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) Gryon mischa Kozlov & Kononova, 1989: 80, 94 (original description, keyed); Kozlov & Kononova, 1990: 268, 294 (description, keyed); Johnson, 1992: 388 (cataloged, type information); Kononova, 1995: 85 (keyed); Kononova & Petrov, 2002: 56 (keyed); Kononova & Kozlov, 2008: 330, 413 (description, keyed); Komeda, Mita, Hirose & Yamagishi, 2020: 106 (junior synonym of Gryon japonicum (Ashmead)). Hadronotus javensis Dodd, comb. rev. Hadronotus javensis Dodd, 1914e: 162 (original description); Dodd, 1915: 19 (keyed); Kieffer, 1926: 454, 460 (description, keyed). Gryon javense (Dodd): Johnson, 1992: 385 (cataloged, type information). Comments. We return this species to Hadronotus based on the original description, “Head and thorax reticulately rugulose.” Hadronotus karnalensis (Chacko & Katiyar), comb. nov. Hadrophanurus karnalensis Chacko & Katiyar, 1961: 161 (original description); Subba Rao & Chacko, 1962: 479 (keyed). Gryon karnalense Chacko & Katiyar: Johnson, 1992: 385 (cataloged). Comments. We transfer this species based on the original description, “frons with a median longitudinal shallow depression with transverse striations and with a keel at the base of the antennae.” Hadronotus kelnerpillauti (Mineo), comb. nov. Holotype images: https://zenodo.org/record/4507021#.YB lab31OlaQ. Gryon kelnerpillauti Mineo, 1983b: 286, 287 (original description, keyed); Johnson, 1992: 386 (cataloged, type information). Hadronotus kenyotus (Mineo), comb. nov. Paratype images: https://zenodo.org/record/5018401#.YNnQgklKhaQ Gryon kenyotum Mineo, 1982b: 304 (original description); Mineo, 1990c: 90 (keyed); Johnson, 1992: 386 (cataloged, type information); Mineo, 1992: 17 (assignment to /etus species group). Comments. This species belongs in Hadronotus based on examination of a paratype specimen as well as characters from the original description, “The series of basiconic- A maximalist approach to the systematics of Gryon aetherium 427 type sensilla, lying on the middle of the ventral surface of the antennomeres Al2-A7 is 2,2,2,2,2,0. Frontal depression enframed all round, its upper side connected to the median ocellus by a ledge.” Hadronotus kozlovi (Ozdikmen), comb. nov. Holotype images: https://zenodo.org/record/5600460#.YXgfFfnMJaQ. Gryon oculatum Kozlov & Kononova, 2004: 205 (original description); Kononova & Kozlov, 2008: 325, 360 (description, keyed). Gryon kozlovi Ozdikmen, 2011: 772 (replacement name for Gryon oculatum Kozlov & Kononova); Timokhov, 2019a: 19 (distribution). Comments. Figure 3—8 of the original description illustrates a female antenna with five clavomeres. Hadronotus krishnagiriensis (Sharma), comb. nov. Holotype images in MBD: USNMENT01109961 Gryon krishnagiriensis Sharma, 1982: 333, 336 (original description, keyed). Gryon krishnagiriense Sharma: Johnson, 1992: 386 (cataloged). Hadronotus laticeps Kieffer, comb. rev. Hadronotus laticeps Kieffer, 1908: 144 (original description); Kieffer, 1926: 453, 457 (description, keyed). Hadronotus Laticeps Kieffer: Kieffer, 1913: 240 (description). Gryon laticeps (Kieffer): Johnson, 1992: 386 (cataloged, type information). Comments. We transfer this species based on the original description, “superficial frontal impression, going beyond the middle of the eyes, dull, not marginal, ridged across.” Hadronotus latipennis (Dodd), comb. nov. Holotype images in MBD: SAMA 1.1396 Platyteleia latipennis Dodd, 1913a: 154 (original description); Dodd, 1914b: 80 (description of female); Kieffer, 1926: 409 (description, keyed); Galloway, 1976: 101 (type information). Gryon latipennis (Dodd): Galloway & Austin, 1984: 79 (generic transfer). Gryon latipenne (Dodd): Johnson, 1992: 386 (cataloged, type information). 428 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) Hadronotus latus (Dodd) comb.n. AustrosceliolatusDodd, 1916: 28 (originaldescription); Galloway, 1976: 85 (typeinformation). Gryon latus (Dodd): Galloway & Austin, 1984: 80 (generic transfer). Gryon latum (Dodd): Mineo, 1990b: 52 (assigned to insulare species group, type infor- mation); Johnson, 1992: 386 (cataloged, type information). Comments. We transfer this species into Hadronotus based on the original description, “Head...with rather shallow open raised reticulation, the lower half or more of face rather shallowly depressed and transversely striate.” Hadronotus leptocorisae Howard, comb. rev. Lectotype images in MBD: USNMENT00989859 Neolectotype images in MBD: USNMENT00989860 Hadronotus leptocorisae Howard, in Hubbard 1885: 215 (original description); Ash- mead, 1893: 230, 231 (description, keyed); Brues, 1910: 47 (keyed); Kieffer, 1926: 454, 462 (description, keyed). Hadronotus hungaricus Szabé, 1966: 430, 433 (original description, keyed. Pre- occupied by Hadronotellus hungaricus Szabé (1966) and Pannongryon hung- aricum Szab6é (1966). Synonymized by Mineo (1980)); Johnson, 1992: 386 (type information). Gryon leptocorisae (Howard): Muesebeck & Masner, 1967: 299 (generic trans- fer); Masner & Muesebeck, 1968: 36 (lectotype designation); Mineo, 1980a: 197 (synonymy); Mineo, 1981la: 119, 132 (variation, keyed); Masner, 1983: 154 (description); Mineo, 1990b: 52 (assigned to leptocorisae species group); Johnson, 1992: 386 (cataloged, type information); Mineo & Caleca, 1994: 122 (distribution); Kononova & Kozlov, 2008: 326, 370 (description, keyed); Talamas, Thompson, Cutler, Schoenberger, Cuminale, Jung, Johnson, Valerio, Smith, Haltermann, Alvarez, Schwantes, Blewer, Bodenreider, Salzberg, Luo, Meislin & Buffington, 2017b: 199 (neotype designation); Timokhov, 2019b: 47 (catalog of species of Russia). Gryon reduviophagus Kozlov, 1971: 48 (original description. Synonymized by Mineo (1979a)); Viggiani & Mineo, 1974: 154, 160 (diagnosis, keyed); Kozlov, 1978: 620 (description); Mineo, 1979a: 257 (junior synonym of Gryon hungaricus (Sz- abd)); Kozlov & Kononova, 1989: 79 (keyed); Kozlov & Kononova, 1990: 267, 285 (description, keyed); Johnson, 1992: 387 (cataloged, type information); Kon- onova, 1995: 84 (keyed); Kononova & Petrov, 2002: 54 (keyed). Hadronotus leptoglossi (Mineo & Caleca), comb. nov. Holotype images: https://zenodo.org/record/4507209#. YB leSnlOlaQ. A maximalist approach to the systematics of Gryon aetherium 429 Gryon leptoglossi Mineo & Caleca, 1987a: 35 (original description); Johnson, 1992: 387 (cataloged). Hadronotus letus Nixon, comb. rev. Syntype images: https://zenodo.org/record/4507293#. YB 1hPX1OlaQ. Hadronotus letus Nixon, 1934b: 292, 309 (original description, keyed); Risbec, 1950: 592 (keyed). Gryon letus (Nixon): Masner, 1965: 77 (type information, generic transfer); Mineo, 1982b: 306 (description); Mineo, 1990c: 90 (keyed); Johnson, 1992: 387 (cata- loged, type information). Hadronotus linshcostei (Masner), comb. nov. Holotype images: https://zenodo.org/record/4507540#.YB1n131OlaQ Gryon linshcostei Masner, 1975: 211, 213 (original description, keyed); Sarazin, 1986: 975 (type information); Johnson, 1992: 387 (cataloged, type information). Hadronotus longicornis (Dodd), comb. nov. Holotype images: https://zenodo.org/record/4507654#. YB 1s4H1OlaQ Plastogryon longicornis Dodd, 1915: 25 (original description, keyed). Gryon longicornis (Dodd): Galloway, 1976: 91 (type information, generic transfer). Gryon longicorne (Dodd): Mineo, 1990a: 185 (emendation, type information); John- son, 1992: 387 (cataloged, type information). Hadronotus longus (Kozlov & Lé), comb. nov. Holotype images in MBD: IEBR 0165 Gryon longum Kozlov & Lé, 1992: 228, 236 (original description, assigned to muscae- forme species group, keyed). Gryon longus Kozlov & Lé, 1996: 11 (description); Lé, 2000: 98, 121 (description, keyed, type information). Hadronotus lucmon (Mineo), comb. nov. Holotype images: https://zenodo.org/record/4507771#.YBlu_nlOlaQ Gryon lucmon Mineo, 1992: 19 (original description). 430 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) Hadronotus magnoculo (Mineo), comb. nov. Holotype images: https://zenodo.org/record/4507836#.YBlwSXlOlaQ Gryon magnoculo Mineo, 1983c: 547, 551 (original description, keyed); Johnson, 1992: 387 (cataloged, type information). Hadronotus longipennis (Masner), comb. nov. Holotype images in MBD: CNC No. 17014 Gryon longipenne Masner, 1983: 134, 156 (original description, keyed); Sarazin, 1986: 975 (type information); Johnson, 1992: 387 (cataloged, type information). Gryon masneri Ozdikmen: Ozdikmen, 2011: 772 (replacement name for Gryon lon- gipenne Masner). Comments. The transfer of this species to Hadronotus makes the replacement name unnec- essary. However, it should be noted that the generic placement of Gryon longipenne (Dodd) is dubious and that it could be transferred to Hadronotus in the future. In this case, the re- placement name would be reinstated, making this species Hadronotus masneri (Ozdikmen). Hadronotus masoni (Masner), comb. nov. Holotype images: https://cnc.agr.gc.ca/taxonomy/Specimen.php?id=2956 Gryon masoni Masner, 1979: 794, 800 (original description, keyed); Sarazin, 1986: 976 (type information); Johnson, 1992: 388 (cataloged, type information). Hadronotus meridianus (Dodd), comb. nov. Holotype images: https://zenodo.org/record/4507953#. YB lzkxlOlaQ. Hadronotoides meridianus Dodd, 1914c: 101 (original description); Kieffer, 1926: 474, 475 (description, keyed); Galloway, 1976: 92 (type information); Johnson, 1992: 399 (cataloged, type information); Naumann, Cardale, Taylor & MacDonald, 1994: 71 (holotype, allotype transferred to ANIC). Gryon meridianum (Dodd): Caleca, 1990: 119, 122 (description, generic transfer, keyed). Hadronotus mirperusi (Risbec), comb. rev. Holotype images: https://zenodo.org/record/4508988#. YB2N2GFKhaQ Hadronotus mirperusi Risbec, 1950: 592, 595 (original description, keyed). A maximalist approach to the systematics of Gryon aetherium 431 Gryon mirperusi (Risbec): Masner, 1976: 58 (generic transfer, type information); Mineo, 1983b: 286, 288 (description, keyed); Johnson, 1992: 388 (cataloged, type information). Hadronotus mnemosynis (Mineo), comb. nov. Paratype images: https://zenodo.org/record/5018405#.YNnQUOIKhaQ Gryon mnemosyne Mineo, 1992: 19 (original description) Comments. The original description is extremely short and insufhcient for generic place- ment. We transfer this species to Hadronotus based on examination of a paratype speci- men and because Mineo (1992) treated it as part of the /iberus group which, to the extent that we have examined primary types directly, is comprised entirely of Hadronotus species. Hadronotus molinai Blanchard, comb. rev. Hadronotus molinai Blanchard, 1927: 598 (original description). Gryon molinai (Blanchard): De Santis & Esquivel, 1966: 50 (generic transfer); Loiad- cono, 1980: 175 (description); Johnson, 1992: 389 (cataloged, type information). Comments. We transfer this species based on characters from the original description, “Head and face with polygonal reticulations. Mesonotum and scutellum strongly and coarsely punctate, assuming at caudal margin of mesonotum a slightly longitudinal direction.” Figures of this species illustrate coarse sculpturing on the frons. Hadronotus morosus (Mineo), comb. nov. Paratype images: https://zenodo.org/record/5037813#.YNoNKUIKhaQ. Gryon morosum Mineo, 1983a: 15, 21 (original description, keyed); Johnson, 1992: 390 (cataloged, type information). Comments. We transfer this species based on illustrations in the original description and its assignment to the charon species group, as well as our examination of a paratype specimen. Hadronotus mudugeriensis Sharma, comb. nov. Holotype images in MBD: USNMENT01109969 Gryon mudugeriense Sharma, 1982: 334, 336 (original description, keyed); Johnson, 1992: 390 (cataloged). 432 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) Hadronotus muscaeformis (Nees von Esenbeck), comb. rev. Teleas muscaeformis Nees von Esenbeck, 1834: 290 (original description); Graham, 1988: 28 (type information). Hadronotus muscaeformis (Nees von Esenbeck): Mayr, 1879: 698 (generic transfer, de- scription); Kieffer, 1926: 453, 459 (description, keyed); Szabd, 1966: 430-431 (de- scription, synonymy, lectotype designation, keyed); Hellén, 1971: 22 (description). Hadronotus pubescens Kieffer, 1909: 269 (original description. Synonymized by Mineo (1981)); Kieffer, 1926: 453, 458 (description, keyed); Bin, 1974: 455 (type infor- mation); Mineo, 1981: 138 (type information). Hadronotus Pubescens Kieffer: Kieffer, 1913: 241 (description). Hadronotus Muscaeformis (Nees von Esenbeck): Kieffer, 1913: 243 (description). Gryon muscaeformis (Nees von Esenbeck): Kozlov, 1971: 47 (generic transfer, distribu- tion, host association); Viggiani & Mineo, 1974: 149, 160, 161 (description, keyed); Kozlov, 1978: 620 (keyed); Mineo, 1981: 120, 134 (synonymy, keyed); Kozlov & Kononova, 1989: 78 (keyed); Kozlov & Kononova, 1990: 266, 269 (description, keyed); Johnson, 1992: 390 (cataloged); Kononova & Petrov, 2002: 54 (keyed). Gryon muscaeforme (Nees von Esenbeck): Kononova & Kozlov, 2008: 325, 365 (de- scription, keyed); Timokhov, 2019b: 48 (catalog of species of Russia). Comments. We transfer this species based on the description of the lectotype desig- nated by Szabé (1966), “Head... wrinkled fine and dense leather-like dots everywhere, except for the striated forehead impression.” Hadronotus myndus Nixon, comb. rev. Paratype images: https://zenodo.org/record/5110092#.YPGnw-hKhaQ Hadronotus myndus Nixon, 1934b: 292, 309 (original description, keyed); Risbec, 1950: 592 (keyed). Hadronotus Benoiti Risbec, 1958: 116 (original description. Synonymized by Mineo (1990a)); Mineo, 1990a: 177 (diagnosis, synonymy); Johnson, 1992: 390 (type information). Gryon myndus ‘Nixon): Masner, 1965: 77 (type information, generic transfer); Mineo, 1990a: 177 (diagnosis, synonymy); Johnson, 1992: 390 (cataloged, type information). Gryon benoiti (Risbec): Masner, 1976: 58 (generic transfer). Hadronotus naevius Nixon, comb. rev. Holotype images: https://zenodo.org/record/4509106#.YB2RLHIOlaQ Hadronotus naevius Nixon, 1934b: 292, 311 (original description, keyed); Risbec, 1950: 592, 597 (description, keyed). Gryon naevius (Nixon): Masner, 1965: 77 (type information, generic transfer); Mineo, 1990a: 177 (variation). A maximalist approach to the systematics of Gryon aetherium 433 Gryon naevium (Nixon): Johnson, 1992: 390 (cataloged, type information). Hadronotus narus (Kozlov & Lé), comb. nov. Holotype images in MBD: USNMENT01197908 Gryon narum Kozlov & Lé, 1992: 228, 237 (original description, assigned to muscae- forme species group, keyed). Gryon narus Kozlov & Lé, 1996: 11 (description); Lé, 2000: 99, 127 (description, keyed, type information). Hadronotus neglectus (Mineo), comb. nov. Holotype images: https://zenodo.org/record/4509207#.YB2UDnlOlaQ. Gryon neglectum Mineo, 1979c: 270 (original description); Mineo, 1980b: 222, 224 (description, keyed); Johnson, 1992: 390 (cataloged, type information); Kon- onova & Petrov, 2002: 56 (keyed); Kononova & Kozlov, 2008: 330, 412 (de- scription, keyed). Hadronotus neotropicus (Masner), comb. nov. Gryon neotropicus Masner, 1979: 804, 792 (original description, keyed) Comments. We transfer this species based on its placement in the variicorne species group and characters in the original description, “...frontal depression very shallow with strongly transverse polygons, not particularly margined at sides nor above... frons along inner orbits and vertex with large polygons.” Hadronotus nereus (Mineo), comb. nov. Holotype images: https://zenodo.org/record/4509257#.YB2V131OlaQ. Gryon nereum Mineo, 1994: 118 (original description, assigned to insulare group). Hadronotus nicolai (Mineo), comb. nov. Holotype images: https://zenodo.org/record/4509338#.YB2YIXIOlaQ Gryon nicolai Mineo, 1979a: 258 (original description); Mineo, 1981a: 119 (keyed); Johnson, 1992: 391 (cataloged, type information); Kononova & Petrov, 2002: 54 (keyed); Mineo, 2004a: 175 (description, distribution in Sicily); Kononova & Ko- zlov, 2008: 324, 357 (description, keyed). 434 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) Hadronotus nigriclavatus (Dodd), comb. rev. Holotype images: https://zenodo.org/record/4509350#. YIHgQaEpBaQ Hadronotus nigriclavatus Dodd, 1913a: 178 (original description); Dodd, 1915: 19 (keyed); Kieffer, 1926: 455, 470 (description, keyed). Gryon nigriclavatus (Dodd): Galloway, 1976: 92 (type information, generic transfer). Gryon nigriclavatum (Dodd): Mineo, 1990b: 57 (description, type information); John- son, 1992: 391 (cataloged, type information); Mineo, 1992: 17 (assignment to letus species group). Hadronotus nigricornis (Dodd), comb. rev. Telenomoides nigricornis Dodd, 1913a: 170, 171 (original description, keyed). Hadronotus nigricornis (Dodd): Dodd, 1914a: 129 (generic transfer); Dodd, 1915: 19 (keyed); Kieffer, 1926: 456, 472 (description, keyed); Galloway, 1976: 111 (type information, status uncertain). Hadronotus fellah Priesner, 1951: 131 (original description. Synonymized by Mineo (1990a)); Mineo, 1990a: 182 (junior synonym of Gryon nigricorne (Dodd)); John- son, 1992: 391 (type information). Gryon fellah (Priesner): Mineo, 1979a: 246 (description of male, generic transfer, type information); Mineo, 1980b: 222, 223 (description, keyed). Gryon nigricorne (Dodd): Mineo, 1990a: 182 (synonymy, generic transfer, emendation); Johnson, 1992: 391 (cataloged, type information); Mineo & Caleca, 1994: 115 (distri- bution, biology); Kononova & Kozlov, 2008: 331, 416 (description, keyed, synonymy). Gryon incrassatum Kononova & Fursov: Kononova & Fursov, 2005a: 592 (original description); Kononova & Fursov, 2005b: 301 (description); Kononova & Kozlov, 2008: 416 (junior synonym of Gryon nigricorne (Dodd)). Comments. The original description is of no use for placing this species in either Gryon or Hadronotus. Mineo (1990) illustrated a female antenna of this species as having five clavomeres but did not clarify if this was the holotype specimen. He men- tioned that type material was examined but did not clarify if this was type material of H. fellah, H. nigricornis, or both. Hadronotus fellah clearly belongs in Hadronotus based on images of the holotype (USNMENT01059669). However, H. fellah was described from Egypt, and while it is possible that 1. fellah and H. nigricornis are conspecific, we consider it prudent to reexamine this synonymy. Hadronotus nigricoxus Dodd, comb. rev. Hadronotus nigricoxa Dodd, 1913a: 179 (original description); Dodd, 1914d: 19 (keyed); Kieffer, 1926: 455, 473 (description, keyed); Galloway & Austin, 1984: 94 (type information, status uncertain); Johnson, 1992: 511 (cataloged, type information). A maximalist approach to the systematics of Gryon aetherium 435 Gryon nigricoxa (Dodd): Mineo, 1990b: 56 (description, type information); Mineo, 1992: 17 (assignment to /etus species group). Comments. The original description is inadequate for determining the genus to which this species belongs. All that remains of the holotype specimen of 1. nigricoxa is a slide mounted fore wing. The body of the holotype was examined by Mineo (1990b), who considered it to be close to Gryon letus. This forms our basis for transferring the species to Hadronotus. Hadronotus nigripes Dodd, comb. rev. Holotype images: https://zenodo.org/record/4509632#.YJmiKKEpBaQ Hadronotus nigripes Dodd, 1914a: 129 (original description); Dodd, 1915: 19 (keyed); Kieffer, 1926: 456, 472 (description, keyed). Gryon nigripes (Dodd): Galloway, 1976: 92 (type information, generic transfer); Mineo, 1990b: 57 (type information); Johnson, 1992: 391 (cataloged, type information). Hadronotus niger (Dodd), comb. nov. Holotype images: https://zenodo.org/record/4509640#.YB24qxXlOlaQ Plastogryon niger Dodd, 1914: 257 (original description). Plastogryon niger niger Dodd: Dodd, 1915: 25 (keyed). Plastogryon niger rubrifemur Dodd, 1915: 25, 26 (original description, keyed); John- son, 1992: 391 (type information). Plastogryon (Heterogryon) niger Dodd: Kieffer, 1926: 447, 450 (description, subgeneric assignment, keyed). Gryon niger (Dodd): Galloway, 1976: 92 (type information, generic transfer); Masner, 1976: 58 (generic transfer). Gryon niger rubrifemur (Dodd): Galloway, 1976: 92 (type information, generic transfer). Gryon nigrum (Dodd): Mineo, 1990b: 54 (distribution); Johnson, 1992: 391 (cata- loged, type information). Hadronotus nigroides (Subba Rao & Chacko), comb. nov. Hadrophanurus nigroides Subba Rao & Chacko, 1962: 477-479 (original description, keyed). Gryon nigroides (Subba Rao & Chacko): Johnson, 1992: 392 (cataloged, type in- formation). ¢ Comments. We transfer this species based on the original description, “...frons with a very shallow area having transverse striations and a small keel at the base 436 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) of the antennae... Mandible threedentate... mesonotum pitted and aciculate in between the pits.” Hadronotus nudus (Mineo), comb. nov. Holotype images: https://zenodo.org/record/4509650#.YB26NX1OlaQ Gryon nudum Mineo, 1994: 118 (original description, assigned to insulare group). Hadronotus obesus (Masner), comb. nov. Holotype images: https://zenodo.org/record/4509675#.YB29031OlaQ. Gryon obesum Masner, 1983: 134, 158 (original description, keyed); Johnson, 1992: 392 (cataloged, type information); Talamas, Johnson & Bufhngton, 2015: 52 (keyed). Hadronotus obtusus (Kozlov & Kononova), comb. nov. Holotype images: https://zenodo.org/record/5600445#.YXgdAPnMJaQ Gryon obtusum Kozlov & Kononova, 2004: 203, 206 (original description); Kononova & Kozlov, 2008: 325, 368 (description, keyed); Timokhov, 2019b: 48 (catalog of species of Russia). Hadronotus oculatus (Mineo), comb. nov. Holotype images: https://zenodo.org/record/4519481#.YCFaQH|IOlaQ Gryon oculatum Mineo, 1983c: 548, 551 (original description, keyed); Johnson, 1992: 392 (cataloged, type information). Hadronotus odontogonusi (Risbec), comb. nov. Lectotype images: https://zenodo.org/record/4519522#.YCFcEXIOlaQ Anteromorpha odontogonusi Risbec, 1955: 199 (original description); Risbec, 1957: 147 (keyed). Gryon odontogonusi (Risbec): Mineo, 1980b: 214 (type information, generic transfer); Mineo, 1990b: 50 (description, lectotype designation, assigned to Aiberus species group); Johnson, 1992: 392 (cataloged, type information). Hadronotus onorei (Mineo), comb. nov. Holotype images: https://zenodo.org/record/4519537#.YCFhpnlOlaQ A maximalist approach to the systematics of Gryon aetherium 437 Gryon onorei Mineo, 1994: 122 (original description, assigned to J/eptocorisae group). Hadronotus oophagus Nixon, comb. nov. Hadronotus oophagus Nixon, 1934a: 3-4, 2 (original description, keyed). Comments. The key to species in the original description provides a character that enables us tro transfer this species to Hadronotus, “Frontal impression completely mar- gined by a sharply defined ridge.” Hadronotus oresteus (Mineo), comb. nov. Gryon oresteum Mineo, 1992: 22 (original description) Comments. We transfer this species to Hadronotus based on the original description, which stated that this species was close to 17. orestes (junior synonym of H. flavipes) and described the sculpture of the frontal depression as “the transverse striae are fine and very compact each other.” Hadronotus oxitomus (Kononova), comb. nov. Gryon oxitomum Kononova: Kononova, Pavlicek & Nevo, 2005: 813 (description); Kononova, Pavlicek & Nevo, 2005: 1355 (original description); Kononova & Ko- zlov, 2008: 322, 339 (description, keyed). Comments. Figure 3-1 in the original description illustrates a frons that is coarsely sculptured and has transverse striation in the frontal depression. Hadronotus pappi (Mineo), comb. nov. Holotype images: https://zenodo.org/record/4519608#.YCFjR31OlaQ. Gryon pappi Mineo, 1983c: 537, 546 (original description, keyed); Johnson, 1992: 393 (cataloged, type information). Hadronotus paracharontis (Mineo), comb. nov. Holotype images: https://zenodo.org/record/4519618#.YCFjI31IOlaQ Gryon paracharontis Mineo, 1982b: 307 (original description); Mineo, 1983a: 18 (keyed); Johnson, 1992: 393 (cataloged, type information). 438 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) Hadronotus paracous (Mineo), comb. nov. Holotype images: https://zenodo.org/record/4519703#.YCFmDX1OlaQ. Gryon paracoum Mineo, 1983c: 538, 546 (original description, keyed); Sarazin, 1986: 977 (type information); Johnson, 1992: 393 (cataloged, type information). Hadronotus parakenyotus (Mineo), comb. nov. Holotype images: https://zenodo.org/record/4519733#.YCFo931OlaQ Gryon parakenyotum Mineo, 1990c: 90 (original description, keyed). Hadronotus parasomaliensis (Mineo), comb. nov. Holotype images: https://zenodo.org/record/4519751#.YCFp9XlOlaQ. Gryon parasomaliense Mineo, 1983c: 539, 546 (original description, keyed); Sarazin, 1986: 978 (type information); Johnson, 1992: 393 (cataloged, type information). Hadronotus pecki (Mineo), comb. nov. Holotype images in MBD: CNC No. 21408 Gryon pecki Mineo, 1990a: 176 (original description); Johnson, 1992: 393 (cataloged, type information). Hadronotus peckorum (Masner), comb. nov. Holotype images: https://cnc.agr.gc.ca/taxonomy/Specimen.php?id=2958 Gryon peckorum Masner, 1979: 793, 803 (original description, keyed); Sarazin, 1986: 978 (type information); Johnson, 1992: 393 (cataloged, type information). Hadronotus pennsylvanicus (Ashmead), comb. nov. Figure 12; Holotype images: https://zenodo.org/record/452025 1#.YCGBzxlOlaQ. ?Telenomus pennsylvanicus Ashmead, 1893: 144, 160 (original description, keyed). Hadronotus ajax Girault, 1920: 181 (original description. Synonymized by Masner (1983)); Masner, 1983: 146 (junior synonym of Gryon pennsylvanicum (Ash- mead)); Johnson, 1992: 394 (type information). Hadrophanurus pennsylvanicus (Ashmead): Kieffer, 1926: 130 (description, generic transfer). Hadronotus atriscapus Gahan, 1927: 37 (original description. Synonymized with Had- ronotus ajax Girault by Mineo (1980a), with Telenomus pennsylvanicus Ashmead, A maximalist approach to the systematics of Gryon aetherium 439 by Masner (1983)); Mineo, 1980a: 189 (junior synonym of Hadronotus ajax Gi- rault); Masner, 1983: 147 (junior synonym of Gryon pennsylvanicum (Ashmead)); Johnson, 1992: 394 (type information). Gryon pennsylvanicus (Ashmead): Masner, 1961: 162 (description, generic transfer); Subba Rao & Chacko, 1962: 480 (keyed). Gryon ajax (Girault): Muesebeck & Masner, 1967: 299 (generic transfer); Masner & Muesebeck, 1968: 34 (lectotype designation); Mineo, 1980a: 189 (synonymy). Gryon atriscapus (Gahan): Muesebeck & Masner, 1967: 299 (generic transfer); Masner & Muesebeck, 1968: 34 (type information). Gryon pennsylvanicum (Ashmead): Masner, 1983: 134, 146 (description, synonymy, emen- dation, keyed); Mineo & Caleca, 1987a: 33 (description); Johnson, 1992: 394 (cata- loged, type information); Kononova & Kozlov, 2008: 331, 419 (description, keyed). Hadronotus pentatomus Dodd, comb. rev. Holotype images in MBD: SAMA DB 32-001664 Hadronotus pentatomus Dodd, 1913a: 154 (original description). Hadronotoides pentatomus (Dodd): Dodd, 1913b: 171 (generic transfer); Kieffer, 1926: 474, 475 (description, keyed); Galloway, 1976: 92 (type information); Masner, 1976: 59 (description); Johnson, 1992: 400 (cataloged, type informa- tion). Gryon pentatomum (Dodd): Caleca, 1990: 119, 125 (description, generic transfer, keyed). Hadronotus perthi Mineo, comb. nov. Holotype images: https://zenodo.org/record/4520576#.YCGFAXIOlaQ Gryon perthi Mineo, 1994: 114, 115 (original description, assigned to irsutioculum group). Hadronotus pharaonis (Mineo), comb. nov. Gryon pharaone Mineo, 1992: 24 (original description). Comments. The original description is pitifully brief and lists only a few general color characters. Mineo (1992) considered this species to belong to the /irsutioculum group, which is our basis for transferring the species to Hadronotus. Hadronotus philippinensis Ashmead, comb. rev. Lectotype image of 1. philippinensis in MBD: USNMENT00989863; Holotype im- ages of H. hakonensis in MBD: USNMENT00989856 440 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) Hadronotus philippinensis Ashmead, 1904b: 11 (original description); Ashmead, 1904d: 153 (distribution); Kieffer, 1926: 454, 460 (description, keyed); Baltazar, 1966: 183 (cataloged, type information, distribution). Hadronotus hakonensis Ashmead, 1904c: 74 (original description); Kieffer, 1926: 453, 460 (description, keyed); Watanabe, 1951: 24, 25 (description, keyed). Hadronotus homoeoceri Nixon, 1934: 4 (original description. Synonymized by Mineo (1979)); Mineo, 1979a: 260 (junior synonym of Gryon philippinensis (Ashmead)); Johnson, 1992: 394 (type information). Hadronotus homoceri Nixon: Mani, 1941: 27 (spelling error). Gryon homeoceri (Nixon): Masner, 1965: 76 (type information, generic trans- fer, spelling error); Mani & Sharma, 1982: 191 (description); Sharma, 1982: 331, 336 (description, keyed). Gryon philippinensis (Ashmead): Masner & Muesebeck, 1968: 36 (lectotype designa- tion, generic transfer). Gryon hakonensis (Ashmead): Masner & Muesebeck, 1968: 35 (type information, ge- neric transfer). Gryon philippinense (Ashmead): Mineo, 1983a: 18, 21 (description, emendation, keyed); Mineo, 1990b: 48 (host information); Johnson, 1992: 394 (cataloged, type information); Lé, 2000: 98, 130 (description, keyed). Gryon hakonense (Ashmead): Mineo, 1981la: 119, 129 (description, emendation, keyed); Johnson, 1992: 384 (cataloged, type information); Kononova & Kozlov, 2008: 442 (description); Komeda, Mita, Hirose & Yamagishi, 2020: 106 (junior synonym of Gryon philippinensis (Ashmead)). Hadronotus papuensis (Caleca), comb. nov. Gryon papuense Caleca, 1990a: 119, 123 (original description, keyed). Comments. Figures 28a—d in the original description clearly indicate that this species belongs in Hadronotus. Hadronotus pictus (Mineo), comb. nov. Holotype images: https://zenodo.org/record/4509618#.YJLcAGEpBaQ Plastogryon nigricornis Dodd, 1914b: 80 (original description); Dodd, 1915: 25 (keyed). Plastogryon (Heterogryon) nigricornis Dodd: Kieffer, 1926: 446, 449 (description, sub- generic assignment, keyed). Gryon nigricornis (Dodd): Galloway, 1976: 92 (type information, generic transfer). Gryon pictum Mineo: Mineo, 1990b: 55 (replacement name for Plastogryon nigricornis Dodd, type information). Gryon nigricorne (Dodd): Johnson, 1992: 391 (cataloged, type information). A maximalist approach to the systematics of Gryon aetherium 44] Hadronotus pisonis (Mineo), comb. nov. Holotype images: https://zenodo.org/record/4520622#.YCGGJ HlOlaQ. Gryon pisone Mineo, 1994: 118 (original description, assigned to insulare group). Hadronotus primus (Kozlov & Kononova), comb. nov. Holotype images: https://zenodo.org/record/4531992#.YCQwc3lOlaQ Gryon primum Kozlov & Kononova, 2004: 206 (original description); Konon- ova & Kozlov, 2008: 326, 371 (description, keyed); Timokhov, 2019b: 48 (catalog of species of Russia). Hadronotus pubescens (Motschoulsky), comb. nov. Holotype images: https://zenodo.org/record/4924954#. YOSoF0OI|KhaQ Muscidea pubescens Motschoulsky, 1863: 70 (original description). Gryon pubescens (Motschoulsky): Masner, 1976: 57 (generic transfer, type informa- tion); Johnson, 1992: 395 (cataloged, type information). Hadronotus querulus (Mineo), comb. nov. Gryon querulum Mineo, 1991: 17 (original description, assigned to muscaeforme species group); Comments. Figure II in Mineo (1991) illustrates a female antenna that has five cla- vomeres and the description states that this species has “mandibles tridentate”, “epomia D> reaching far from the tegula’, “frons...with almost regular polygons; the same sculpture is found on the mesoscutum.” Hadronotus radicularis (Masner), comb. nov. Holotype images in MBD: CNC No. 17016 Gryon radiculare Masner, 1983: 134, 160 (original description, keyed); Sarazin, 1986: 978 (type information); Johnson, 1992: 395 (cataloged, type information). Hadronotus religiosus (Mineo), comb. nov. Gryon religiosum Mineo, 1994: 130 (original description). 442 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) Comments. We transfer this species based on characters in the original description, “frontal depression deep and large, all over margined by keel; crossed by wide apart parallel striations; clava of 6 antennomeres.” However, this description also mentions a character that requires further examination, “above malar groove a fan-like striation with wide apart striae.” Hadronotus reticulatus (Dodd), comb. rev. Hadronotus reticulatus Dodd, 1914c: 102 (original description). Hadronotoides reticulatus (Dodd): Kieffer, 1926: 474, 475 (description, keyed); Gal- loway, 1976: 92 (type information); Johnson, 1992: 400 (cataloged, type informa- tion). Gryon reticulatum (Dodd): Caleca, 1990: 119, 130 (description, generic transfer, keyed, lectotype designation). Comments. Our transfer of this species is based on the original description, “Head, scutum and scutellum reather coarsely rugulose,” as well as the description and illustra- tion of the lectotype and inclusion in pentatomum group by Caleca (1990). Hadronotus rhinocori (Risbec), comb. nov. Holotype images: https://zenodo.org/record/4520837#. YCGK9XIOlaQ. Paragryon rhinocori Risbec, 1950: 583 (original description). Gryon rhinocori (Risbec): Masner, 1976: 58 (generic transfer, type information, sys- tematic position); Johnson, 1992: 395 (cataloged, type information). Hadronotus robertae (Mineo), comb. nov. Paratype images: https://zenodo.org/record/5037817#.YNoNBEIKhaQ Gryon robertae Mineo, 1981a: 119, 141 (original description, keyed); Johnson, 1992: 395 (cataloged, type information); Kononova & Petrov, 2002: 54 (keyed); Kon- onova & Kozlov, 2008: 324, 353 (description, keyed). Comments. We transfer this species to Hadronotus based on Figure XX] in the original description and examination of a paratype specimen. Hadronotus robustus (Dodd), comb. nov. Holotype images: https://zenodo.org/record/4521184#.YCGZ931OlaQ. A maximalist approach to the systematics of Gryon aetherium 443 Austroscelio robustus Dodd, 1914c: 94 (original description); Kieffer, 1926: 473, 474 (description, keyed); Galloway, 1976: 85 (type information); Naumann, Cardale, Taylor & MacDonald, 1994: 71 (holotype transferred to ANIC). Gryon robustus (Dodd): Galloway & Austin, 1984: 80 (generic transfer). Gryon robustum (Dodd): Johnson, 1992: 395 (cataloged, type information); Mineo & Caleca, 1994: 117 (description, distribution). Hadronotus rothi (Masner), comb. nov. Holotype images: https://zenodo.org/record/4521187#.YCGbKXIOlaQ. Gryon rothi Masner, 1979: 793, 797 (original description, keyed); Mas- ner, 1983: 134, 151 (description, keyed); Johnson, 1992: 395 (cataloged, type information). Hadronotus rubriscapus Dodd, comb. rev. Holotype images: https://zenodo.org/record/4521205#.YCGfhxlOlaQ. Hadronotus rubriscapus Dodd, 1915: 21 (original description). Gryon rubriscapus (Dodd): Galloway, 1976: 92 (type information, generic transfer); Johnson, 1992: 395 (cataloged, type information). Hadronotus rufithorax (Dodd), comb. rev. Holotype images: https://zenodo.org/record/4521209#.YInQhvlKhaQ; https://zeno- do.org/record/4726161#.YInU7PIKhaQ Hadronotus rufithorax Dodd, 1913b: 172 (original description). Plastogryon nigriceps Dodd, 1914a: 125 (original description. Preoccupied by Hadrono- tus nigriceps Dodd (1914)); Dodd, 1915: 24 (keyed); Mineo, 1990b: 55 (junior synonym of Gryon rufithorax (Dodd)). Plastogryon rufithorax (Dodd): Dodd, 1914a: 125 (generic transfer); Dodd, 1915: 24 (keyed). Plastogryon (Heterogryon) nigriceps Dodd: Kieffer, 1926: 447, 450 (description, subge- neric assignment, keyed). Plastogryon (Heterogryon) rufithorax (Dodd): Kieffer, 1926: 446, 449 (description, sub- generic assignment, keyed). Gryon nigriceps (Dodd): Galloway, 1976: 92 (type information, generic transfer). Gryon rufithorax (Dodd): Galloway, 1976: 92 (type information, generic transfer); Mi- neo, 1990b: 55 (synonymy); Johnson, 1992: 395 (cataloged, type information). Gryon magneticus Galloway: Galloway & Austin, 1984: 79 (replacement name). Gryon magneticum Galloway: Johnson, 1992: 387 (cataloged, type information). 444 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) Hadronotus rufiventris (Kononova), comb. nov. Paratype images: https://zenodo.org/record/5600439#.YXgbyPnMJaQ Gryon rufiventris Kononova, 2001: 1469 (original description); Kononova & Petroy, 2002: 53 (keyed); Fabritius & Popovici, 2007: 14, 16 (description, keyed). Gryon rufiventre Kononova: Kononova & Kozlov, 2008: 323, 343 (description, keyed). Hadronotus rugiceps Ashmead, comb. rev. Holotype images in MBD: USNMENT00989865 Hadronotus rugiceps Ashmead, 1893: 231, 233 (original description, keyed); Brues, 1910: 47 (keyed); Kieffer, 1926: 454, 463 (description, keyed). Gryon rugiceps (Ashmead): Muesebeck & Masner, 1967: 299 (generic transfer); Masner & Muesebeck, 1968: 36 (type information); Masner, 1983: 134, 155 (description, keyed); Johnson, 1992: 395 (cataloged, type information). Hadronotus rugosithorax Ashmead, comb. rev. Hadronotus rugosithorax Ashmead, 1896: 799 (original description); Ashmead, 1900: 328 (distribution); Kieffer, 1926: 455, 467 (description, keyed). Gryon rugosithorax (Ashmead): Masner, 1965: 78 (type information, generic transfer); Masner, 1976: 58 (description, systematic position); Johnson, 1992: 396 (cata- loged, type information). 4 Comments. We transfer this species based on the original description which states “... the facial impression bounded by a raised margin, transversely striated.” Hadronotus rugostriatus (Dodd), comb. nov. Hadronotoides rugostriatus Dodd, 1920a: 352 (original description); Masner, 1965: 78 (type information); Johnson, 1992: 400 (cataloged, type information). Comments. We transfer this species to Hadronotus based on characters from the origi- nal description, “Head transverse... coarsely densely rugose... scutum and scutellum very coarsely rugose.” Hadronotus rugulosus Fouts, comb. rev. Hadronotus rugulosus Fouts, 1934: 103 (original description). A maximalist approach to the systematics of Gryon aetherium 445 Gryon rugulosus (Fouts): Bin, 1974: 463 (generic transfer, type information); Masner, 1976: 58 (description, systematic position). Gryon rugulosum (Fouts): Mineo, 1983b: 286, 290 (description, emendation, keyed); Mineo, 1990a: 183 (variation); Johnson, 1992: 396 (cataloged, type information). Comments. We transfer this species based on the original description, “...frons with a shallow antennal depression below, strongly transversely striate.” Hadronotus samoensis (Mineo), comb. nov. Gryon samoense Mineo, 1991: 8 (original description, assigned to charon species group). Comments. This species is transferred to Hadronotus based on the original description and assignment to the charon group: “...the frontal depression are finely scabrous; this latter is transversely crossed by undulating wrinkles.” Hadronotus sancti (Mineo), comb. nov. Holotype images: https://zenodo.org/record/4521215#.YCGh2nIOlaQ Gryon sancti Mineo, 1983c: 539, 546 (original description, keyed); Johnson, 1992: 396 (cataloged, type information). Hadronotus saxatilis Kieffer, comb. rev. Holotype images: https://zenodo.org/record/4521231#.YCGjnnlOlaQ Hadronotus saxatilis Kieffer, 1910: 293 (original description); Kieffer, 1912: 56 (rede- scribed as new, keyed); Kieffer, 1926: 454, 461 (description, keyed); Nixon, 1934b: 292, 293 (description, keyed); Risbec, 1950: 592 (keyed). Gryon saxatilis (Kieffer): Masner, 1965: 78 (type information, generic transfer). Gryon saxatile (Kieffer): Mineo, 1983b: 286, 291 (description, emendation, keyed); Mineo, 1990a: 184 (description); Johnson, 1992: 396 (cataloged, type informa- tion); Mineo & Caleca, 1994: 115 (distribution, biology). Hadronotus scapicompressus (Mineo), comb. nov. Holotype images: https://zenodo.org/record/4521248#.YCGka31OlaQ Gryon scapicompressum Mineo, 1994: 123 (original description, assigned to leptocorisae group). 446 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) Hadronotus scorsonis (Mineo), comb. nov. Holotype images: https://zenodo.org/record/4521250#.YCGIUHIOlaQ Gryon scorsonis Mineo, 1990a: 180, 181, 182 (original description, diagnosis); John- son, 1992: 396 (cataloged, type information). Hadronotus scutellatus (Masner), comb. nov. Gryon scutellatus Masner, 1979: 800, 792 (original description, keyed) Comments. We transfer this species based on its placement in the variicorne group dur- ing its original description: “All 15 species described in this paper share the following characters in common... frontal depression very shallow... its sculpture consisting of a chain of transverse polygons above antennal insertion; clypeus small, receding, unarmed” Hadronotus scutidepressi (Mineo), comb. nov. Holotype images: https://zenodo.org/record/4521254#.YCGI2X1OlaQ Gryon scutidepressi Mineo, 1983b: 286, 292 (original description, keyed); Johnson, 1992: 396 (cataloged). Hadronotus semirufus (Kononova), comb. nov. Gryon semirufum Kononova, 2005: 1356 (original description); Kononova, Pavlicek & Nevo, 2005: 814 (description); Kononova & Kozlov, 2008: 322, 341 (description, keyed). Comments. We transfer this species to Hadronotus based on the original description, “The occiput is covered with arcuate wrinkles... The frontal depression is shallow, not bordered by an arcuate keel, shining, with lateral wrinkles...” Figures included in the publication clarify the description. Hadronotus sersis (Mineo), comb. nov. Gryon serse Mineo, 1992: 24 (original description) Comments. We transfer this species based on the original description, “Frontal depres- sion moderately deep, large and topped, above the central keel crossed by coarse and moderately upcurved striae.” A maximalist approach to the systematics of Gryon aetherium 447 Hadronotus sesbaniae Risbec, comb. rev. Lectotype images: https://zenodo.org/record/4521276#.YFJ/H_K9KhaQ. Hadronotus sesbaniae Risbec, 1956: 247 (original description). Gryon sesbaniae (Risbec): Mineo, 1980b: 214 (type information, generic transfer); Johnson, 1992: 396 (cataloged, type information). Hadronotus shisha (Komeda & Mita), comb. nov. Gryon shisa Komeda & Mita, in Komeda, Mita, Hirose & Yamagishi, 2020: 124, 128 (original description, keyed). Comments. Our generic transfer is based on images and characters in the original description. Hadronotus sibiricus (Kononova), comb. nov. Gryon sibiricus Kononova, in Kononova & Petrov, 2001: 1472 (original description). Gryon sibiricum Kononova: Kononova & Kozlov, 2008: 355, 322 (description, keyed); Timokhoy, 2019b: 48 (catalog of species of Russia). Comments. We transfer this species based on the original description, “The head is honeycomb... Frons with longitudinal carina, with distinct transverse wrinkles extend- ing from this carina.” Hadronotus sinop (Masner), comb. nov. Gryon sinop Masner, 1979: 793, 802 (original description, keyed); Sarazin, 1986: 978 (type information); Johnson, 1992: 396 (cataloged, type information). Comments. We transfer this species based on placement in variicorne group and original de- scription: “frontal depression shallow but unusually well indicated by lateral and dorsal keels as well as sculpture consisting of several large transverse polygons above antennal insertion...” Hadronotus somaliensis (Mineo), comb. nov. Holotype images: https://zenodo.org/record/4521278#.YCGp931OlaQ Gryon somaliense Mineo, 1983c: 540, 546 (original description, keyed); Johnson, 1992: 396 (cataloged). 448 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) Hadronotus sponus (Kozlov & Lé), comb. nov. Holotype images in MBD: IEBR 0138 Gryon sponum Kozlov & Lé, 1992: 235, 238 (original description, assigned to muscae- forme species group, keyed). Gryon sponus Kozlov & Lé, 1996: 11 (description); Lé, 2000: 98, 133 (description, keyed, type information). Hadronotus stewarti (Masner), comb. nov. Holotype images in MBD: CNC No. 17013 Gryon stewarti Masner, 1983: 134, 152 (original description, keyed); Sarazin, 1986: 979 (type information); Johnson, 1992: 396 (cataloged, type information). Hadronotus striatus Dodd, comb. rev. Holotype images: https://zenodo.org/record/4521303#.YCGuonlOlaQ Hadronotus striatus Dodd, 1913a: 155 (original description); Dodd, 1914d: 19 (keyed); Kieffer, 1926: 455, 470 (description, keyed); Galloway, 1976: 111 (type information, status uncertain); Johnson, 1992: 511 (cataloged, type information). Hadronotus strongist (Kozlov & Lé), comb. nov. Holotype images in MBD: IEBR 0142 Gryon strongist Kozlov & Lé, 1992: 225, 227 (original description, assigned to insu- lare species group, keyed); 1996: 11 (description); Lé, 2000: 98, 134 (description, keyed, type information). Hadronotus sulawensis (Mineo), comb. nov. Holotype images: https://zenodo.org/record/4521310#.YCGwo3lOlaQ Gryon sulawense Mineo, 1990a: 181 (original description); Johnson, 1992: 397 (cata- loged, type information). Hadronotus superbus (Kononova), comb. nov. Holotype images: https://zenodo.org/record/5159846#.YQq2MORKhaQ A maximalist approach to the systematics of Gryon aetherium 449 Gryon superbus Kononova, 1984: 78 (original description); Kozlov & Kononova, 1989: 80 (keyed); Kozlov & Kononova, 1990: 268, 295 (description, keyed); Kononova & Petrov, 2002: 56 (keyed). Gryon superbum Kononova: Johnson, 1992: 397 (cataloged, type information); Kon- onova & Kozlov, 2008: 328, 395 (description, keyed). Comments. We transfer this species based on the original description, “The forehead is comparatively well pronounced, not limited to the keels, transversely striated,” and im- ages of the holotype female that illustrate the setose metapleuron, foveae along anterior T1, and an antenna with five clavomeres. Hadronotus suvaensis Dodd Hadronotus suvaensis Dodd, 1914d: 161 (original description); Dodd, 1915: 19 (keyed); Kieffer, 1926: 455, 470 (description, keyed). Comments. We consider that this species belongs in Hadronotus based on the original description, “Face transversely rugulose.” Hadronotus testaceus (Subba Rao & Chacko), comb. nov. Hadrophanurus testaceus Subba Rao & Chacko, 1962: 476, 480 (original description, keyed). Gryon testaceum (Subba Rao & Chacko): Johnson, 1992: 397 (cataloged, type informa- tion). Comments. We transfer this species based on the original description, “frons with a longitudinal shallow depression having transverse striations.” Hadronotus tetartus (Kononova), comb. nov. Gryon tetartus Kononova, 2008: 325, 361 (original description, keyed). Comments. We transfer this species based on characters from the original description, “Frontal impression superficial, with distinct longitudinal carina, transversely striated.” Hadronotus texanus (Kozlov & Kononova), comb. nov. Holotype images: https://zenodo.org/record/4532088#. YCQyY31OlaQ 450 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) Gryon texanum Kozlov & Kononova, 2004: 207 (original description); Kononova & Kozlov, 2008: 327, 382 (description, keyed); Timokhov, 2019a: 19 (distribution). Hadronotus titan (Masner), comb. nov. Gryon titan Masner, 1979: 794, 801 (original description, keyed); Sarazin, 1986: 979 (type information); Johnson, 1992: 397 (cataloged, type information). Comments. This species is transferred based on placement in variicorne group. From the original description, “All 15 species described in this paper share the following char- acters in common... frontal depression very shallow... its sculpture consisting of a chain of transverse polygons above antennal insertion; clypeus small, receding, unarmed.” Hadronotus tonkinensis (Kozlov & Lé), comb. nov. Holotype images in MBD: IEBR 0168 Gryon tonkinense Kozlov & Lé, 1992: 231, 237 (original description, assigned to mus- caeforme species group, keyed). Gryon tonkinensis Kozlov & Lé, 1996: 12 (description); Lé, 2000: 99, 135 (description, keyed, type information). Hadronotus triatomae (Masner), comb. nov. Holotype images: https://zenodo.org/record/4521335#.YCGlanlOlaQ Gryon triatomae Masner, 1975: 209, 211 (original description, keyed); Johnson, 1992: 397 (cataloged, type information). Hadronotus tricoloris (Mineo), comb. nov. Holotype images: https://zenodo.org/record/4521343#.YCG2HnIOlaQ. Gryon tricolore Mineo, 1991: 16 (original description, assigned to /eptocorisae species group). Hadronotus tridentatus (Masner), comb. nov. Gryon tridentatus Masner, 1979: 793, 796 (original description, keyed); Sarazin, 1986: 979 (type information). Gryon tridentatum Masner: Johnson, 1992: 397 (cataloged, type information). A maximalist approach to the systematics of Gryon aetherium 451 Comments. This species is transferred based on placement in variicorne group. From the original description, “All 15 species described in this paper share the following char- acters in common... frontal depression very shallow... its sculpture consisting of a chain of transverse polygons above antennal insertion; clypeus small, receding, unarmed” Hadronotus tropicalis Caleca, comb. nov. Holotype images: https://zenodo.org/deposit/4521357 Gryon tropicale Caleca, 1990a: 119, 132 (original description, keyed). Hadronotus unicolor (Dodd), comb. nov. Holotype images: https://zenodo.org/record/4726101#.YInH1flKhaQ. Plastogryon unicolor Dodd, 1914a: 125 (original description); Dodd, 1915: 25 (keyed). Plastogryon (Heterogryon) unicolor Dodd: Kieffer, 1926: 447, 450 (description, subge- neric assignment, keyed). Gryon unicolor (Dodd): Galloway, 1976: 92 (type information, generic transfer); John- son, 1992: 397 (cataloged, type information). Hadronotus urinius (Kozlov & Lé), comb. nov. Holotype images in MBD: IEBR 0169 Gryon urinium Kozlov & Lé, 1992: 225, 227 (original description, assigned to insulare species group, keyed). Gryon urinius Kozlov & Lé, 1996: 10 (description); Lé, 2000: 98, 136 (description, keyed, type information). Hadronotus urus (Mineo), comb. nov. Holotype images: https://zenodo.org/record/4521361#.YCG31HIOlaQ. Gryon urum Mineo, 1982b: 311 (original description); Mineo 1983a (keyed). Comments. [ransferred based on assignment to the charonspecies group. The holotypeis lost. Hadronotus variicornis Fouts, comb. rev. Holotype images in MBD: USNMENT00989867 Hadronotus variicornis Fouts, 1925: 149 (original description). 452 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) Gryon variicornis (Fouts): Masner & Muesebeck, 1968: 36 (type information, generic transfer); Masner, 1979: 793, 801 (description, keyed). Gryon variicorne (Fouts): Johnson, 1992: 397 (cataloged, type information). Hadronotus varius (Kozlov & Lé), comb. nov. Paratype images in MBD: USNMENT01197901 Gryon varium Kozlov & Lé, 1992: 229, 237 (original description, assigned to muscae- forme species group, keyed). Gryon varius Kozlov & Lé, 1996: 11 (description); Lé, 2000: 99, 137 (description, keyed, type information). Hadronotus viggianii (Mineo), comb. nov. Paratype images: https://zenodo.org/record/5037829#.YNoMzklKhaQ Gryon viggianii Mineo, 1980b: 218 (original description, keyed); Johnson, 1992: 398 (cataloged, type information); Kononova & Petrov, 2002: 56 (keyed); Kononova & Kozlov, 2008: 331, 417 (description, keyed). Comments. The original description is brief and inadequate for generic placement of this species. We transfer it to Hadronotus based on Figure II-3, which illustrates trans- verse striation on the frons, and our examination of a paratype specimen. Hadronotus vitripennis (Masner), comb. nov. Holotype images in MBD: USNMENT01059242 Gryon vitripenne Masner, 1983: 135, 149 (original description, keyed); Johnson, 1992: 398 (cataloged, type information). Hadronotus watshami (Mineo), comb. nov. Holotype images: https://zenodo.org/record/4521367#.YCG4uxlOlaQ Gryon watshami Mineo, 1983c: 544, 546 (original description, keyed); Johnson, 1992: 398 (cataloged). Hadronotus watussus (Mineo), comb. nov. Paratype images: https://zenodo.org/record/5037856#.YNoMiUIKhaQ A maximalist approach to the systematics of Gryon aetherium 453 Gryon watussum Mineo, 1992: 20 (original description) Comments. The description of this species is absurdly brief, but states, “the sculpture of the mesoscutum and scutellum that is all over strigose in G. watussum sp.n.” and indicates that this species is morphologically similar to G. hiberus (=H. hiberus). This, in combination with examination of a paratype specimen, leads us to place it in Had- ronotus. Hadronotus wintes (Kozlov & Lé), comb. nov. Holotype images in MBD: IEBR 0171 Gryon wintes Kozlov & Lé, 1992: 224, 227 (original description, assigned to insulare species group, keyed); Kozlov & Lé, 1996: 10 (description); Lé, 2000: 97, 98, 139 (description, keyed, type information, synonymy). Gryon thoum Kozlov & Lé, 1992: 224, 227 (original description, assigned to insulare species group, keyed). Gryon thous Kozlov & Lé, 1996: 10 (description); Lé, 2000: 139 (junior synonym of Gryon wintes Kozlov & Lé). Hadronotus xanthosoma (Masner), comb. nov. Holotype images in MBD: CNC No. 17017 Gryon xanthosoma Masner, 1983: 133, 164 (original description, keyed); Sarazin, 1986: 979 (type information); Johnson, 1992: 398 (cataloged, type information). Hadronotus yamagishii (Mineo), comb. nov. Paratype images: https://zenodo.org/record/5037860#.YNoMZkIKhaQ Gryon yamagishii Mineo, 198 1a: 143, 119 (original description, keyed) Gryon maruzzae Mineo, 198 1a: 134, 119 (original description, keyed); Komeda, Mita, Hirose & Yamagishi, 2020: 115 (junior synonym of Gryon yamagishii Mineo). Gryon sugonjaevi Kozlov & Kononova, 1989: 78, 81 (original description, keyed); Ko- zlov & Kononova, 1990: 266, 274 (description, keyed); Johnson, 1992: 397 (cata- loged, type information); Kononova, 1995: 81 (keyed); Kononova & Petrov, 2002: 54 (keyed); Kononova & Kozlov, 2008: 324, 354 (description, keyed); Komeda, Mita, Hirose & Yamagishi, 2020: 115 (junior synonym of Gryon yamagishii Mineo). Comments. Images of the holotypes of Gryon yamagishii Mineo and Gryon maruzzae Mineo are available in Komeda et al. (2020). 454 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) Hadronotus zimbabwensis (Mineo), comb. nov. Holotype images: https://zenodo.org/record/4521373#.YCRZJHIOlaQ Gryon zimbabwense Mineo, 1983c: 549, 551 (original description, keyed); Johnson, 1992: 398 (cataloged). Phylogenetic placement of Maruzza The concatenated alignment consisted of 493 taxa, 2,709 sites (base pairs plus gaps), and 31.9% missing data. Maruzza japonica was recovered in a moderately-supported clade composed of the Psix-group of genera (Psix Kozlov & Lé, Paratelenomus Dodd) and Mantibaria Kirby (58% UFBS) (Figure 95). This grouping was sister to Hadrono- tus (49% UFBS). In our initial phylogenetic analyses, the placement of Mantibaria was variable and we do not consider the genus to be a member of the Psix-group. This is the first phylogenetic analysis to include a species of Maruzza, and our results support its inclusion in the Psix-group of genera as proposed by Johnson (1985, 1988a). Generic transfers to Dyscritobaeus Perkins Dyscritobaeus cates (Kozlov & Lé), comb. nov. Holotype images in MBD: USNMENT01223667 Gryon cates Kozlov & Lé, 1992: 217, 221 (original description, assigned to misellum species group, keyed); Kozlov & Lé, 1996: 9 (original description); Lé, 2000: 96, 106 (description, keyed, type information). Dyscritobaeus cones (Kozlov & Lé), comb. nov. Paratype images in MBD: USNMENT01197891 Gryon cones Kozlov & Lé, 1992: 217, 221 (original description, assigned to misellum species group, keyed). Gryon comes Kozlov & Lé, 1996: 9 (description, misspelling); Lé, 2000: 96, 109 (de- scription, keyed, type information). Dyscritobaeus ennius Kononova & Fursov, comb. nov. Gryon ennius Kononova & Fursov, 2005a: 595 (original description); Kononova & Fursov, 2005b: 304 (description); Kononova & Kozlov, 2008: 329, 407 (description, keyed). Comments. The arrangement of the ocelli in a relatively compact triangle and the shape of the metascutellum in Figure 4 of the original description provide the basis for transferring this species to Dyscritobaeus. A maximalist approach to the systematics of Gryon aetherium 455 Dyscritobaeus menerus (Kozlov & Lé), comb. nov. Paratype images in MBD: USNMENT01223628 Gryon menerum Kozlov & Lé, 1992: 218, 221 (original description, assigned to misel- lum species group, keyed). Gryon menerus Kozlov & Lé, 1996: 10 (description); Lé, 2000: 97, 122 (description, keyed, type information). Dyscritobaeus morinus (Kozlov & Lé), comb. nov. Paratype images in MBD: USNMENT01223646 Gryon morinum Kozlov & Lé, 1992: 215, 220 (original description, assigned to misel- lum species group, keyed). Gryon morinus Kozlov & Lé, 1996: 10 (description); Lé, 2000: 96, 125 (description, keyed, type information). Dyscritobaeus notoocellus (Kozlov & Lé) comb. nov. Holotype images in MBD: IEBR 0172 Gryon notoocellum Kozlov & Lé, 1992: 215, 221 (original description, assigned to mis- ellum species group, keyed). Gryon notoocellus Kozlov & Lé, 1996: 9 (description); Lé, 2000: 96, 129 (description, keyed, type information). Relationships in Gryonini Tortorici et al. (2016) summarized various hypotheses of relationship between Dyscri- tobaeus and Gryon, some of which were not in agreement. Considering our findings, it is not surprising that competing ideas emerged about the phylogenetic proximity of these genera, given that results would vary widely if authors compared Dyscritobaeus to specimens of Hadronotus or Gryon. Our molecular analysis supports Dyscritobaeus as part of Gryonini, and it can easily be separated from Gryon by having five clavomeres, the absence of subgenual spines, a metapleuron with setation outside of the anterodor- sal corner, and a non-striate axillula. Both Gryon and Dyscritobaeus have a sublateral carina and lateral pit on T1. In their revision of Afrotropical Dyscritobaeus, Tortorici et al. (2016) did not mention the lat- eral pit on Tl per se, but essentially evaluated this character via the presence of the sub- lateral carina that is directly mesad (Figure 104). Interestingly, Tortorici et al. (2016) noted that these carinae are absent in four of the five brachypterous species that they treated. As part of this study, we examined a small number of Encyrtoscelio species and found a similar pattern. The sublateral carina and lateral pit are found in the macrop- terous E. odorata Kozlov & Lé (Figure 108) and are absent in a brachypterous species 456 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323—480 (2021) 100 Telenominae sensu Taekul et al. (2015) OSUC248080 Mantibaria sp. PL205 Maruzza japonica OSUC248206 Paratelenomus saccharalis OSUC248211 Psix sp. OSUC266779 Psix tunetanus Hadronotus Figure 95. Phylogenetic placement of Maruzza japonica based on an expanded maximum likelihood phylogenetic analysis of the original multi-gene dataset (Figure 1) plus taxa for which only COI sequences were available. Values above branches indicate ultrafast bootstrap support values. (Figure 109). To examine this pattern further, we imaged a specimen of the brachypter- ous G. brevipenne in a scanning electron microscope (Figures 113-116). This species has a striate axillula (Figure 113) and subgenual spines on the hind tibia (Figure 115), so we do not doubt its generic placement. The wings of G. brevipenne are reduced (Figure 113), but not as severely as the brachypterous Encyrtoscelio in Figures 109-110 or the brachypterous Dyscritobaeus in Tortorici et al. (2016), and it exhibits an inter- mediate level of reduction in other characters: the lateral pit on T1 is present, but the sublateral carina is absent (Figure 113); the claval formula is 1-2-2-1, whereas most Gryon have a 1-2-2-2 formula and the most reduced state is 1-2-2 (Figure 39). These findings suggest that the loss of structures on T1 is associated with living in leaf litter or a similar niche in which wings are not advantageous. The functional reasons are un- known, as the internal morphology associated with the structures on lateral T1 has not been examined. The brachypterous specimen of Encyrtoscelio that we examined has two subgenual spines on the hind tibia (Figure 111), indicating that this character is less susceptible to reduction. To our knowledge, all species of Gryon have either two or four subgenual spines, and their number may yield some phylogenetic signal. At present, we consider it unlikely that Encyrtoscelio is a lineage derived from within Gryon, as it can be separated by having five clavomeres (Figure 107), setation in the posterodorsal part of the metapleuron (Figure 109), and form of the axillula (Figures 108-109). However, this hypothesis remains to be formally tested. Discussion COI barcoding Decentralized COI barcoding activities contribute to a global biodiversity research in- frastructure that democratizes species identification to non-experts. This paradigm is A maximalist approach to the systematics of Gryon aetherium 457 02 mm 99 0.2mm Figures 96-99. Maruzza japonica (FSCA 00094686, PL205 in Figure 95), female 96 habitus, dorsal view 97 habitus, lateral view 98 head and mesosoma, anterolateral view 99 wings, dorsal view. especially valuable when researching understudied, hyperdiverse lineages of economic importance. Many surprising discoveries of regulatory and agro-economic consequence surely await to be found as these data accumulate and are analyzed at a global scale. The case of G. aetherium presented here illustrates, once again, the utility of COI barcodes for detecting and tracking the geographic spread of biological control agents under evaluation (Ganjisaffar et al. 2018; Stahl et al. 2019; Goltz et al. 2020). We suspect that there are many similar, yet undetected, cases to be found among already avail- able barcode data. COI barcoding for platygastroids is rapidly expanding, with BOLD containing nearly 90,000 public barcode sequences for the superfamily. Almost 50,000 additional platygastroid barcodes are awaiting public release. However, the utility of platygastroid COI barcodes is diminished by a lack of iden- tified material. Only 357 species names have been applied to the approximately 90,000 public barcodes in BOLD. A huge portion of the available data are only identified to the family-level. Thus, we recommend that a primary research objective for the hyme- nopterist community should be to apply at least generic names to these public data whenever possible, either by examination of images associated with BOLD BINs or voucher specimens housed in collections. A second concern is that the apparently widespread amino acid evolution in Sce- lionidae is, in part, causing COI barcodes in GenBank to be labeled as “unverified”. This is due to the GenBank quality-control infrastructure being unable to confirm the 458 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) amino acid translations of submitted barcode sequences. This is consequential because unverified sequences in GenBank will not appear as hits in BLAST searches, poten- tially obfuscating the identification of uncommon genera or species. Further compli- cating matters, our small survey of scelionid COI barcode amino acids suggests that several protein phenotypes are present in the family. NCBI requires the following in- formation to remove “unverified” labels in GenBank: 1) new sequences in fasta format, 2) sequencing technology and assembly program used, 3) properly formatted feature tables for the new annotations, and 4) an additional piece of supporting evidence such as: RID of BLAST analysis, multiple sequence alignments, peer-reviewed publications discussing the specific annotations, or evidence from wet-bench experiments. We rec- ommend that the COI barcode annotations provided in this study be used to begin justifying the removal of the “unverified” comments in GenBank or prevent the label from being applied to newly gathered data. COI data analyzed in this study supported our identification of Gryon aetherium specimens. The success rate of COI identifications across Gryon and Hadronotus is not yet possible to determine, but preliminary results are promising. Terminal clusters ap- pear to have divergences that could provide statistically supported identifications for many species and COI amino acid phenotypes supported our separation of Gryon and Hadronotus. Pentinsaari et al. (2016) suggested that the evolution of shortened COI sequences, and genomes more broadly, is associated with endoparasitic life histories. Whether the variable deletion of amino acids in COI loops in these genera is associated with differences in parasitoid biology would be a fascinating line of research. Phylogenetics Our ability to determine that Gryon and Hadronotus are separate lineages was facilitat- ed by the dataset of Chen et al. (2021), which provided a framework for relationships throughout Scelionidae. In this regard, large-scale phylogenetic projects are invaluable for efficient completion of smaller analyses. Each of our molecular analyses retrieved Gryonini as sister to Telenominae sensu Taekul et al. (2014) and the Psix group was always retrieved outside of Gryonini+Telenominae, supporting the delimitation of Telenominae by Taekul et al. (2014). The analysis by Chen et al. (2021) retrieved Gryon as sister to Dyscritobaeus, but reexamination of the Gryon specimens in that study finds that they belong to Hadronotus. This is significantly different from our analyses, which did not recover Dyscritobaeus near Hadronotus. We suspect that this result was influenced by taxon sampling because the analysis of Chen et al. (2021) did not actually contain Gryon and our analyses focused intensely on Gryon and Hadrono- tus. Clearly, there remains much to be resolved regarding the systematics of these taxa. Implications for biological control Detection of adventive G. aetherium in California and Mexico continues a trend of adventive scelionid biological control agents of stink bug eggs and emphasizes that A maximalist approach to the systematics of Gryon aetherium 459 Figures 100-104. Dyscritobaeus sp. (USNMENT01335652) 100 mouthparts, ventrolateral view 101 scutellar-axillar complex, posterolateral view 102 hind femur and tibia, lateral view 103 mesosoma, lateral view 104 T1-T2, posterolateral view. taxonomic preparedness is needed for rapid diagnoses. In the case of G. aetherium, similarities between species and unclear morphological limits contributed to a failure to recognize the adventive population in Mexico (Felipe-Victoriano et al. 2019), which would have accelerated measures to manage the pest. Instead, an incorrect name was applied to the species, as it was for quarantine populations (G. gonikopalense). Despite the setbacks of these misidentifications, the taxonomy of Gryon and Hadronotus has advanced, and we here provide a sounder foundation for contin- ued research. Our eventual identification of G. aetherium and determination of the quarantine and adventive populations of G. aetherium as conspecific are supported by multiple lines of evidence: molecular analysis, morphological comparison, and the interbreeding studies performed by Hogg et al. (2021). In the United States and Mexico, the arrival of G. aetherium provides new prospects for the management of bagrada bug and an opportunity to compare its biology under laboratory and field conditions. The detection of G. aetherium in Israel and South Africa via COI bar- coding provided localities that are not yet known from collections. This, in turn, can inform the geographical breadth of specimens examined for alpha taxonomy and direct foreign exploration to regions that climatically match the invaded range and contain the biological control agent. 460 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) Figures 105-112. 105 Encyrtoscelio (FSCA 00094394), head, lateral view 106 Encyrtoscelio (FSCA 00094394), head, anterior view 107 Encyrtoscelio (FSCA 00094394), antenna, ventral view 108 En- cyrtoscelio odorata (IEBR 0141), head and mesosoma, lateral view 109 Encyrtoscelio (FSCA 00094394), mesosoma and T1, dorsolateral view 110 Encyrtoscelio (FSCA 00094394), mesosoma and metasoma, lateral view 111 Encyrtoscelio (FSCA 00094394), hind tibia, posterior view 112 Gryon (CNC665446), hind tibia, posterior view. As we have made progress, we have also exposed the magnitude of work that re- mains in Gryon and Hadronotus. Our molecular analyses of Gryon indicate that the cur- rent concept of G. myrmecophilum may represent a complex of cryptic species through- out the Nearctic region. Similarly, Gryon in Africa has many species that are challenging to separate by morphology alone. In Hadronotus, at least two species are known to be A maximalist approach to the systematics of Gryon aetherium 461 rs 5 aE Pr ith a : Figures 113-116. Gryon brevipenne (OSUC 395663) 113 mesosoma and metasoma, dorsolateral view 114 mouthparts, anteroventral view 115 hind tibia, posterior view I 16 antennal clava, ventrolateral view. associated with bagrada bug, H. karnalensis from India (Chacko and Katiyar 1961) and an unidentified species from Kenya. We have yet to characterize the former and yet to attach a name to the latter. The images of primary types provided via this publication make it easier to identify species of Gryon and Hadronotus but are not a substitute for synthetic work that determines species limits and produces efficient identification tools. Our taxonomic efforts are ongoing and will undoubtedly inform a variety of biological control programs and ecological studies, including projects in the future and those that are underway. Acknowledgments We have many people to thank for their valuable efforts, this study would not have been possible without them. Museum visits by EJT were hosted by Claire Villement and Agniéle Touret-Alby (MNHN); Maria Tavano and Roberto Poggi (MCSN); Aisha Mayekiso (SAMC); Paolo Visconti (NMINH); Valerie Caron, Ol- ivia Evangelista, and Bronte Sinclair (ANIC); and Ben Parslow (SAMA). A visit to the Canadian National Collection Insects in 2019 was supported by the Ca- nacol Foundation. Numerous type specimens were photographed by colleagues 462 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) who kindly agreed to make them available via this study: Ben Parslow (SAMA), Victor Fursov and Alex Gumovsky (UASK), Cristina Vasilita and Ovidiu Popovici (A.I. Cuza University, Iasi, Romania), Istvan Miké (University of New Hamp- shire, Durham, NH, USA), Rune Bygebjerg (MZLU), Dominique Zimmermann (NHMW) and Lukas Kirschey (MFNB). Specimen loans were provided by Da- vid Notton (NHM), Bob Zuparko (EMEC, CASC), Kevin Williams (CDFA), Matthew Buffington (USNM), Aisha Mayekiso (SAMC), Zoltan Vas (HNHM), Robert Copeland (ICIPE), Andrew Bennett, Jose Fernandez and Lubomir Masner (CNCI). We are grateful to Andrey Ozerov and Alexey Gusakov (ZMMU) for pro- viding an opportunity to study the type of Muscidea pubescens. Collecting efforts in South Africa were assisted by Rene Sforza (USDA/EBCL) and Susana das Neves (University of Stellenbosch). Elijah Talamas, Matthew Moore, Jonathan Bremer, Natalie McGathey, Cheryl Roberts and Lynn A. Combee were supported by the Florida Department of Agriculture and Consumer Services. Travel to Ireland was made possible by a cooperative agreement with Kim A. Hoelmer (USDA/ARS). Travel to France, Italy, and South Africa was made possible by a USDA-APHIS Farm Bill: Biological Control of Bagrada Bug (2018-2020). Lubomir Masner pro- vided many specimens used in our analyses and invaluable discussion on the mor- phological limits of Gryon and Hadronotus. The work of Alexander Timokhov was carried out within the framework of State research assignment 121032300064-0 at Moscow State University. References Alayo Dalmau P (1973) Catalogo de lo himendpteros de Cuba. Instituto Cubano del Libro, La Habana 218 pp. Ashmead WH (1887) Report on insects injurious to garden crops in Florida. Bulletin of the U.S. Department of Agriculture Division of Entomology 14: 9-29. Ashmead WH (1893) A monograph of the North American Proctotrypidae. Bulletin of the United States National Museum 45: 1-472. https://doi.org/10.5479/si.03629236.45.1 Ashmead WH (1894) Report on the parasitic Cynipidae, part of the Braconidae, the Ichneumo- nidae, the Proctotrypidae, and part of the Chalcidinae. Part III. Zoological Journal of the Linnean Society of London 25: 188-254. Ashmead WH (1896) Report on the parasitic Hymenoptera of the island of Grenada, compris- ing the families Cynipidae, Ichneumonidae, Braconidae, and Proctotrypidae. Proceedings of the Zoological Society of London 1895: 742-812. Ashmead WH (1900) Report upon the aculeate Hymenoptera of the islands of St. Vincent and Grenada, with additions to the parasitic Hymenoptera and a list of the described Hyme- noptera of the West Indies. Transactions of the Royal Entomological Society of London 1900: 207-367. https://doi.org/10.1111/j.1365-2311.1900.tb02379.x Ashmead WH (1903) Classification of the pointed-tailed wasps, or the superfamily Proctotry- poidea. — III. Journal of the New York Entomological Society 11: 86-99. A maximalist approach to the systematics of Gryon aetherium 463 Ashmead WH (1904a) Classification of the chalcid flies or the superfamily Chalcidoidea, with de- scriptions of new species in the Carnegie Museum, collected in South America by Herbert H. Smith. Memoirs of the Carnegie Museum 1: 225-551. https://doi.org/10.5962/bhL title. 10341 Ashmead WH (1904b) A list of the Hymenoptera of the Philippine Islands, with descriptions of new species. Journal of the New York Entomological Society 12: 1-22. Ashmead WH (1904c) Descriptions of new Hymenoptera from Japan — I. Journal of the New York Entomological Society 12: 65-84. Ashmead WH (1904d) Descriptions of new genera and species of Hymenoptera from the Phil- ippine Islands. Proceedings of the United States National Museum 28: 127-158. https:// doi.org/10.5479/si.00963801.28-1387.127 Ashmead WH (1905) New genera and species of Hymenoptera from the Philippines. Pro- ceedings of the United States National Museum 29: 397-413. https://doi.org/10.5479/ si.00963801.29-1424.397 Austin AD, Field SA (1997) The ovipositor system of scelionid and platygastrid wasps (Hyme- noptera: Platygastroidea): comparative morphology and phylogenetic implications. Inver- tebrate Taxonomy 11: 1-87. https://doi.org/10.1071/I1T95048 Baltazar CR (1966) A catalogue of Philippine Hymenoptera (with a bibliography, 1758-1963). Pacific Insects Monographs 8: 1-488. Bin F (1974) The types of Scelionidae [Hymenoptera: Proctotrupoidea] in some Italian collec- tions (Museums of Genoa and Florence, Institute of Portici). Entomophaga 19: 453-466. https://doi.org/10.1007/BF02372781 Blanchard E (1840) Histoire naturelle des insectes. Orthoptéres, Névroptéres, Hémipteres, Hyménopteres, Lépidoptéres et Diptéres. Tome 3. PR. Dumenil, Paris 672 pp. https://doi. org/10.5962/bhl.title.59226 Blanchard EE (1927) Two new egg parasites from Argentina. Physis 8: 598-602. Bréthes J (1913) Himendpteros de la America meridional. Anales del Museo Nacional de His- toria Natural de Buenos Aires 24: 35-165. Brues CT (1907) Notes and descriptions of North American parasitic Hymenoptera. V. Bul- letin of the Wisconsin Natural History Society 5: 150-161. Brues CT (1908) Hymenoptera. Fam. Scelionidae. Genera Insectorum 80: 1-59. https://doi. org/10.1093/jee/1.2.123 Brues CT (1910) Notes and descriptions of North American parasitic Hymenoptera. VIII. Bul- letin of the Wisconsin Natural History Society 8: 45—52. Brues CT (1916) Serphoidea (Proctotrypoidea). The Hymenoptera or, wasp-like insects, of Connecticut. Guide to the Insects of Connecticut, Part III. pages 529-577. Brues CT (1940) Fossil parasitic Hymenoptera of the family Scelionidae from Baltic am- ber. Proceedings of the American Academy of Arts & Sciences 74: 69-90. https://doi. org/10.2307/20023360 Brullé A (1846) Histoire naturelle des insects. Hyménoptéres. Tome quatriéme. Librairie Ency- clopédique de Roret Paris 680 pp. Buffington ML, Talamas EJ, Hoelmer KA (2018) Team Trissolcus: Integrating Taxonomy and Biological Control to Combat the Brown Marmorated Stink Bug. American Entomologist 64: 224-232. https://doi.org/10.1093/ae/tmy057 464 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) Buhl PN (1997) Teleas pedestris Nees, 1834 and Hadronotellus pedester Kieffer, 1917 conspecific (Hymenoptera, Scelionidae). Entomologiske Meddelelser 65: 41-44. Bundy CS, Grasswitz TR, Sutherland C (2012) First report of the invasive stink bug Bagrada hilaris (Burmeister) (Heteroptera: Pentatomidae) from New Mexico, with notes on its bi- ology. Southwestern Entomologist 37: 411-414. https://doi.org/10.3958/059.037.0317 Caleca V (1990a) Revision the pentatomus-group of the genus Gryon Haliday, with description of three new species: Gryon chinchillae, G. paupense and G. tropicale (Hymenoptera: Scelio- nidae). Frustula Entomologica 13: 113-138. Caleca V (1990b) Description of Breviscelio arabicus sp. nov. from the Persian Gulf, and of the male of B. crenatus Sundholm (Hym. Scelionidae). Frustula Entomologica 13: 139-143. Caleca V (1992) New data on Breviscelio Sundholm, with description of a new species from South Africa (Hymenoptera, Scelionidae). Phytophaga 4: 49-55. Caleca V, Mineo G (1995) On the genus Dyscritobaeus Perkins, 1910 (Hymenoptera, Proc- totrupoidea: Scelionidae). Bollettino del Laboratorio di Entomologia Agraria “Filippo Sil- vestri’ Portici 50: 9-21. Carpenter FM (1992) Arthropoda 4. Superclass Hexopoda. Treatise on Invertebrate Paleontol- ogy, Part R. The Geological Society of America, Boulder, CO, 655 pp. Chacko MJ, Katiyar RN (1961) Hadrophanurus karnalensis sp. m. (Hymenoptera: Sce- lionidae), a parasite of Bagrada cruciferarum Kirkaldy (Hemiptera: Pentatomidae). Pro- ceedings of the Royal Entomological Society of London 30: 161-163. https://doi. org/10.1111/j.1365-3113.1961.tb00155.x Chen HC, Lahey Z, Talamas EJ, Valerio AA, Popovici OA, Musetti L, Klompen H, Polaszek A, Masner L, Austin AD, Johnson NF (2021) An integrated phylogenetic reassessment of the parasitoid superfamily Platygastroidea (Hymenoptera: Proctotrupomorpha) results in a revised familial classification. Systematic Entomology 46: 1088-1113. https://doi. org/10.1111/syen.12511 Chen H, Talamas EJ, Bon M-C, Moore MR (2020) Gryon ancinla Kozlov & Lé (Hymenoptera: Scelionidae): host association, expanded distribution, redescription and a new synonymy. Biodiversity Data Journal 8: e47687. https://doi.org/10.3897/BDJ.8.e47687 Costa Lima A da (1940) Uma nova especie de Hadronotus (Serphoidea: Scelionidae). Chacaras e Quintaes 62: 81-83. Costa Lima A da (1928) Hadronotus brasiliensis, novo scelionideo parasito de ovos de um corei- deo. Memorias do Instituto Oswaldo Cruz Rio de Janeiro, Suplemento 1: 1-2. https://doi. org/10.1590/S0074-02761928000300001 Cruaud A, Jabbour-Zahab R, Genson G, Cruaud C, Couloux A, Kjellberg E van Noort S, Ras- plus J-Y (2010) Laying the foundations for a new classification of Agaonidae (Hymenop- tera: Chalcidoidea), a multilocus phylogenetic approach. Cladistics 26: 359-387. https:// doi.org/10.1111/j.1096-0031.2009.00291.x Crawford JC (1912) Descriptions of new Hymenoptera. No. 4. Proceedings of the United States National Museum 42: 1-10. https://doi.org/10.5479/si.00963801.42-1880.1 Cresson ET (1887) Synopsis of the families and genera of the Hymenoptera of America, north of Mexico, together with a catalogue of the described species, and a bibliography. Transactions of the American Entomological Society Suppl. 1-351. https://doi.org/10.5962/bhI.title.5531 A maximalist approach to the systematics of Gryon aetherium 465 Dalla Torre CW von (1885) Die hymenopterologischen Arbeiten Prof. Dr. Arn. Foersters. Jah- resb. Naturf. Ges. Graubuendens 28: 44-82. Dalla Torre DG de (1898) Catalogus hymenopterorum hucusque descriptiorum systematicus et syno- nymicus. Vol. V: Chalcididae et Proctotrupidae. Sumptibus Guilelmi Engelmann Lipsiae 598 pp. De Santis L (1967) Catalogo de los himendpteros argentinos de la serie parasitica, incluyendo Bethyloidea. Com. Inv. Cient., Pcia Buenos Aires Gob. La Plata 337 pp. De Santis L, Esquivel L (1966) Tercera lista de himendpteros parasitos y predatores de los insec- tos de la Republica Argentina. Revista del Museo de La Plata 69: 47-215. Dodd AP (1913a) Australian Hymenoptera Proctotrypoidea. No. 1. Transactions of the Royal Society of South Australia 37: 130-181. Dodd AP (1913b) Some new parasitic Hymenoptera from Australia. Archiv fir Naturgeschichte 79: 164-182. Dodd AP (1913c) Some south Queensland Proctotrypoidea. Memoirs of the Queensland Mu- seum 2: 335-339. Dodd AP (1914a) Australian Hymenoptera Proctotrypoidea. No. 2. Transactions of the Royal Society of South Australia 38: 58-131. Dodd AP (1914b) Further additions to the Australian Proctotrypoidea. Archiv ftir Naturge- schichte 79: 164-182. Dodd AP (1914c) Further new genera and species of Australian Proctotrypoidea. Proceedings of the Royal Society of Queensland 26: 91-140. Dodd AP (1914d) Two new Scelionidae from Fiji. Archiv ftir Naturgeschichte 80: 161-162. https://doi.org/10.5962/bhl.part.27689 Dodd AP (1914e) Four new proctotrupoid egg-parasites of sugar cane insects in Java. Archiv fur Naturgeschichte 80: 162-164. https://doi.org/10.5962/bhl.part.27690 Dodd AP (1914f) New Proctotrypoidea from Australia (Hym.). Entomological News 25: 251-257. Dodd AP (1915) Notes and corrections on Australian Prototrypoidea, with descriptions of forty-five new species. Archiv ftir Naturgeschichte 80: 1-32. Dodd AP (1916) Australian Hymenoptera Proctotrypoidea. No. 4. Transactions and Proceed- ings of the Royal Society of South Australia 40: 9-32. Dodd AP (1920) Notes on the exotic Proctotrupoidea in the British and Oxford University Museums, with descriptions of new genera and species. Transactions of the Entomological Society of London 1919: 321-382. https://doi.org/10.1111/j.1365-2311.1920.tb00008.x Dodd AP (1926) Australian Hymenoptera Prototrypoidea. — No. 5. Transactions and Proceed- ings of the Royal Society of South Australia 50: 298-314. Dodd AP (1930) A revision of the Australian Teleasinae (Hymenoptera: Proctotrupoidea). Pro- ceedings of the Linnean Society of New South Wales 55: 41-91. Edgar RC (2004) MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Research 32: 1792-1797. https://doi.org/10.1093/nar/gkh340 Fabritius K, Popovici OA (2007) Tribul Gryonini (Hymenoptera, Scelionidae) din Romania. Geea, Bucuresti, 68 pp. Fatindez EI, Liter A, Cuevas AG, Rider DA, Valdebenito P (2016) First record of the painted bug Bagrada hilaris (Burmeister, 1835) (Heteroptera: Pentatomidae) in South America. Arquivos EntomoldXicos 16: 175-179. 466 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) Felipe-Victoriano M, Talamas EJ, Sanchez-Pefia SR (2019) Scelionidae (Hymenoptera) para- sitizing eggs of Bagrada hilaris (Hemiptera, Pentatomidae) in Mexico. In: Talamas E (Eds) Advances in the Systematics of Platygastroidea II. Journal of Hymenoptera Research 73: 143-152. https://doi.org/10.3897/jhr.73.36654 Fergusson NDM (1978) Proctotrupoidea and Ceraphonoidea. Pages 110-126. In: Kloet GS, Hincks WD second edition (completely revised). Part 4: Hymenoptera. Handbooks for the Identification of British Insects Volume 11, 159 pp. Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R (1994) DNA primers for amplification of mitochondrial Cytochrome C oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3: 294-299. Forster A (1856) Hymenopterologische Studien. I. Heft. Chalcidae und Proctotrupii. Ernst ter Meer, Aachen 152 pp. Forster A (1861) Ein Tag in den Hoch Alpen. Programm der Realschule zu Aachen ftir das Schuljahr 1860/61. Aachen 44 pp. Fouts RM (1920) Some new parasites, with remarks on the genus Platygaster (Hymenoptera). Proceedings of the Entomological Society of Washington 22: 61-72. Fouts RM (1927) Descriptions of new Nearctic Serphoidea (Hymenoptera). Proceedings of the Entomological Society of Washington 29: 165-179. Fouts RM (1934) Report on a small collection of parasitic Hymenoptera from Italian Somali- land. Memorie della Societa Entomologica Italiana 13: 98-109. Fouts RM (1948) Parasitic wasps of the genus Trimorus in North America. Proceedings of the United States National Museum 98: 91-148. https://doi.org/10.5479/si.00963801.98- 522591 Gahan AB (1927) Miscellaneous descriptions of new parasitic Hymenoptera with some syno- nymical notes. Proceedings of the United States National Museum 71: 1—39. https://doi. org/10.5479/si.00963801.71-2676.1 Galloway ID (1976) The types of Australian species of the subfamily Scelioninae (Hymenop- tera: Scelionidae). Queensland Journal of Agricultural and Animal Sciences 33: 83-114. Galloway ID, Austin AD (1984) Revision of the Scelioninae (Hymenoptera: Scelionidae) in Australia. Australian Journal of Zoology Supplementary Series 99: 1-138. https://doi. org/10.1071/AJZS099 Ganjisaftar F, Talamas EJ, Bon M-C, Gonzalez L, Brown BV, Perring TM (2018) Trissolcus hya- linipennis Rajmohana & Narendran (Hymenoptera, Scelionidae), a parasitoid of Bagrada hilaris (Burmeister) (Hemiptera, Pentatomidae), emerges in North America. Journal of Hy- menoptera Research 65: 111-130. https://doi.org/10.3897/jhr.65.25620 Ganjisaffar FE, Talamas EJ, Bon MC, Perring TM (2020) First report and integrated analysis of two native Trissolcus species utilizing Bagrada hilaris eggs in California. Journal of Hyme- noptera Research 80: 49-70. https://doi.org/10.3897/jhr.80.57024 Giard A (1895) Sur quelques especes nouvelles d’ Hymenopteres parasites. Bulletin de la Société Entomologique de France 1895: 74-80. Girault AA (1920) New serphidoid, cynipoid, and chalcidoid Hymenoptera. Proceed- ings of the United States National Museum 58: 177-216. https://doi.org/10.5479/ si.00963801.2332.177 A maximalist approach to the systematics of Gryon aetherium 467 Girault AA (1925) A new parasite of bug eggs (Proctotrypidae). Bulletin of Entomological Re- search 16: e183. https://doi.org/10.1017/S0007485300028522 Girault AA (1932) New Lower Hymenoptera from Australia and India. Privately Published, Brisbane, 6 pp. Goltz NC, Awad J, Moore MR, Talamas EJ (2020) A fortuitous find: a unique haplotype of Ooencyrtus nezarae Ishii (Encyrtidae: Encyrtinae) discovered in Florida. Biodiversity Data Journal 8: e36440. https://doi.org/10.3897/BDJ.8.e36440 Gordh G, Menke AS, Dahms EC, Hall JC (1979) The privately printed papers of A. A. Girault. Memoirs of the American Entomological Institute 28: 1-400. Graham MWR de V (1984) Madeira insects, mainly Hymenoptera Proctotrupoidea, Ceraphro- noidea, and Bethyloidea. Boletim do Museu Municipal do Funchal 36: 83-110. Graham MWR de V (1988) The remains of Nees von Esenbeck’s collection of Hymenoptera in the University Museum, Oxford. Entomologists Monthly Magazine 124: 19-35. Haliday AH (1833) An essay on the classification of the parasitic Hymenoptera of Britain, which correspond with the Ichneumones minuti of Linnaeus. Entomological Magazine 1: 259-276. Harrington WH (1900) Catalogue of Canadian Proctotrypidae. Transactions of the Royal Soci- ety of Canada 5: 169-206. https://doi.org/10.5962/bhl. part.25118 Hebert PDN, Penton EH, Burns JM, Janzen DH, Hallwachs W (2004) Ten species in one: DNA barcoding reveals cryptic species in the neotropical skipper butterfly Astraptes fulgera- tor. PNAS 101: 14812-14817. https://doi.org/10.1073/pnas.0406166101 Hellén W (1971) Die Scelioninen Finnlands (Hymenoptera: Proctotrupoidea). Fauna Fennica 23: 1-25. Heraty J, Hawks D, Kostecki JS, Carmichael A (2004) Phylogeny and behaviour of the Gollumi- ellinae, a new subfamily of the ant-parasitic Eucharitidae (Hymenoptera: Chalcidoidea). Systematic Entomology 29: 544-559. https://doi.org/10.1111/j.0307-6970.2004.00267.x Hoang DT, Chernomor O, von Haeseler A, Minh BQ, Vinh LS (2018) UFBoot2: Improv- ing the ultrafast bootstrap approximation. Molecular Biology and Evolution 35: 518-522. https://doi.org/10.1093/molbev/msx28 1 Hogg BN, Hougardy E, Talamas E (2021) Adventive Gryon aetherium Talamas (Hymenoptera, Scelionidae) associated with eggs of Bagrada hilaris (Burmeister) (Hemiptera, Pentatomidae) in the USA. In: Lahey Z, Talamas E (Eds) Advances in the Systematics of Platygastroidea III. Journal of Hymenoptera Research 87: 481-492. https://doi.org/10.3897/jhr.87.73778 Hougardy E, Hogg BN (2021) Host patch use and potential competitive interactions between two egg parasitoids from the family Scelionidae, candidate biological control agents of Bagrada hilaris (Hemiptera: Pentatomidae). Journal of Economic Entomology 114: 611- 619. https://doi.org/10.1093/jee/toab014 Howard LO (1886) A generic synopsis of the hymenopterous family Proctotrupidae. Transactions of the American Entomological Society 13: 169-178. https://doi. org/10.2307/25076475 Howard LO (1889) A parasite of the supposed eggs of the cotton stainer. Insect Life 1: 241-242. Huang T, Reed DA, Perring TM, Palumbo JC (2014) Feeding damage by Bagrada hilaris (He- miptera: Pentatomidae) and impact on growth and chlorophyll content of Brassicaceous 468 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) plant species. Arthropod-Plant Interactions 8: 89-100. https://doi.org/10.1007/s11829- 014-9289-0 Hubbard HG (1885) Insects affecting the orange. U.S. Department of Agriculture, Division of Entomology, Washington, 227 pp. https://doi.org/10.5962/bhl.title. 11073 Jansson A (1939) Studier 6ver svenska proctotrupider. I. Fér faunan nya slakten. Entomologisk Tidskrift 60: 155-175. Johnson NF (1985) Phylogenetic relationships of the telenomine genus Nirupama (Hymenop- tera: Scelionidae). International Journal of Entomology 27: 369-374. Johnson NF (1988) Mudigere, a new genus of Telenominae (Hymenoptera: Scelionidae) related to the Psix-group of genera. Colemania 5: 25-28. Johnson NF (1988) Species of Australian Telenominae (Hymenoptera: Scelionidae) of A. P Dodd and A. A. Girault. Proceedings of the Entomological Society of Washington 90: 229-243. Johnson NF (1992) Catalog of world Proctotrupoidea excluding Platygastridae. Memoirs of the American Entomological Institute 51: 1-825. Kambhampati S, Smith PT (1995) PCR primers for the amplification of four insect mi- tochondrial gene fragments. Insect Molecular Biology 4: 233-236. https://doi. org/10.1111/}.1365-2583.1995.tb00028.x Kalyaanamoorthy S, Minh BQ, Wong TKF, von Haeseler A, Jermiin LS (2017) ModelFinder: Fast model selection for accurate phylogenetic estimates. Nature Methods 14: 587-589. https://doi.org/10.1038/nmeth.4285 Kieffer JJ (1906) Description de quelques nouveaux serphides. Bulletin de la Société d’ Histoire Naturelle de Metz 25: 1-7. Kieffer JJ (1908) Révision des Scelionidae (Hyménopteéres). Annales de la Société Scientifique de Bruxelles 32: 111-250. Kieffer JJ (1909) Description de quelques nouveaux Scelionides dEurope (Hym.). Bulle- tin de la Société Entomologique de France 1909: 268-271. https://doi.org/10.3406/ bsef.1909.24554 Kieffer JJ (1910) Hymenoptera. Fam. Scelionidae. Addenda et corrigenda. Genera Insectorum 80: 61-112. https://doi.org/10.1515/9783111642000-005 Kieffer JJ (1912) Proctotrypidae (3e partie). Species des Hyménoptéres d’Europe et d’Algérie 11: 1-160. https://doi.org/10.3406/lsoc.1980.1236 Kieffer JJ (1913) Proctotrypidae (3e partie). Species des Hyménopteéres d'Europe et d’Algérie 11: 161-304. Kieffer JJ (1917) Uber neue und bekannte Microhymenopteren. Entomologiske Meddelelser Ie 341-355: Kieffer JJ (1926) Scelionidae. Das Tierreich. Vol. 48. Walter de Gruyter & Co. Berlin 885pp. Komeda Y, Mita T, Hirose Y, Yamagishi K (2020) Taxonomic revision of charon-, floridanum- and muscaeforme-groups of Gryon Haliday, 1833 (Hymenoptera, Scelionidae) from Japan, with descriptions of two new species and host information. Journal of Hymenoptera Re- search 80: 99-135. https://doi.org/10.3897/jhr.80.56178 Kononova SV (1984) [A new species of the genus Gryon Haliday (Hymenoptera, Scelionidae, Scelioninae) from Central Asia.] 78—79.in [Taxonomy and zoogeography of Insects. ] A maximalist approach to the systematics of Gryon aetherium 469 Kononova SV (1995) [25. Fam. Scelionidae.] 57-121 in [Key to insects of Russian Far East in six volume. vol. 4. Neuropteroidea, Mecoptera, Hymenoptera. Part 2. Hymenoptera.] Kononova SV, Fursov VN (2002a) [New species of egg-parasitoids of the family Scelionidae (Hymenoptera, Proctotrupoidea) from Japan.] Zoologicheskii Zhurnal 84: 592-604. Kononova SV, Fursov VN (2002b) New species of egg-parasitoids of the family Scelionidae (Hymenoptera, Proctotrupoidea) from Japan. Entomological Review 85: 301-313. Kononova SV, Kozlov MA (2008) [Scelionids of the Palearctic (Hymenoptera, Scelionidae). Subfamily Scelioninae.] Tovarishchestvo Nauchnykh Izdanii KMK Saint Petersburg 489 pp. Kononova SV, Pavlicek T, Nevo E (2005) New species of egg-parasitoids of the genus Gryon (Hymenoptera, Scelionidae) from Israel. Entomological Review 85: 811-818. Kononova SV, Petrov S (2001) [A review of the genera Gryon and Exon (Hymenoptera, Scelionidae) from the Palaearctic. 1. New species of the genus Gryon.] Zoologicheskii Zhurnal 80: 1468-1480. Kononova SV, Petrov S (2002) [A review of the genera Gryon and Exon (Hymenoptera, Scelio- nidae) from the Palaearctic. 2. A key for identification of Gryon species and a review of the genus Exon.] Zoologicheskii Zhurnal 81: 53-59. Kozlov MA (1963a) New parasitic wasps of the family Scelionidae (Hymenoptera, Proc- totrupoidea) in the fauna of the USSR. Entomological Review 42: 354-358. Kozlov MA (1963b) [New parasitic wasps of the family Scelionidae (Hymenoptera, Proc- totrupoidea) in the fauna of the USSR.] Entomologicheskoye Obozreniye 42: 660-668. Kozlov MA (1963c) [New synonyms of species of the genus Asolcus Nak., Gryon Hal. and Telenomus Hal. (Hymenoptera, Scelionidae), egg parasites of Eurygaster integriceps Put.] Zoologicheskii Zhurnal 42: 294-296. Kozlov MA (1971) [Proctotrupoids (Hymenoptera, Proctotrupoidea) of the USSR.] Trudy Vs- esoyuznogo Entomologicheskogo Obshchestva 54: 3-67. Kozlov MA (1972) [On the fauna of Hymenoptera Proctotrupoidea of the Mongolian People’s Republic. I. Heloridae, Proctotrupidae, Scelionidae.] Insects of Mongolia 1: 645-672. Kozlov MA (1978) [Superfamily Proctotrupoidea]. [Determination of insects of the European portion of the USSR.] Vol. 3, part 2. 538-664. Kozlov MA, Kononova SV (1989) [New species of the genus Gryon Haliday (Hymenoptera, Scelionidae) of the USSR and neighbour countries.] Trudy Zoologicheskogo Instituta Aka- demii Nauk SSSR 188: 78-100. Kozlov MA, Kononova SV (1990) [Scelioninae of the Fauna of the USSR (Hymenoptera, Sce- lionidae, Scelioninae).] Nauka, Leningrad 344 pp. Kozlov MA, Kononova SV (2004) [New species of egg-parasites of the genus Gryon Haliday (Hymenoptera: Scelionidae) of the Palaearctic fauna.] Trudy Russkogo Entomologichesko- go Obshchestva 75: 194-208. Kozlov MA, Lé XH (1992) [New species of the genus Gryon (Hymenoptera, Scelionidae) of the fauna of Vietnam] Pages 210-238. In: [Systematics and Ecology of insects of Vietnam]. Moscow, Nauka. Kumar S, Stecher G, Li M, Knyaz C, Tamura K (2018) MEGA X: Molecular evolutionary genetics analysis across computing platforms. Molecular Phylogenetics and Evolution 35: 1547-1549. https://doi.org/10.1093/molbev/msy096 470 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) Lé XH (1996) Key to egg-parasites of genus Gryon Haliday, 1833 (Hymenoptera: Scelionidae) from Viet Nam. Tap chi Bao ve Thuc vat 5: 9-15. Lé XH (2000) Egg-parasites of family Scelionidae (Hymenoptera). Fauna of Vietnam, vol. 3. Science and Technics Publishing House, Hanoi, 386 pp. Livshits IS, Kuslitskii S (1989) [Beneficial fauna of the orchard.] Agropromizdat, Moscow 320 pp. Loiacono MS (1980) Nota sobre tres escelionidos parasitoides de hemipteros de la Republica Argentina y Brasil (Hymenoptera - Proctotrupoidea). Revista de la Sociedad Entomolégica Argentina 39: 173-178. Loiacono MS, Diaz NB (1996) Los ejemplares tipo de Proctotrupoidea y Ceraphronoidea (Hymenoptera) depositados en la coleccion del Museo de la Plata. Universidad Na- cional de La Plata, Facultad de Ciencias Naturales y Museo, Serie Tecnica y Didactica 23: 1-13. Loiacono MS, Margaria CB (2002) Systematics, morphology and physiology. Ceraphronoidea, Platygastroidea and Proctotrupoidea from Brazil (Hymenoptera). Neotropical Entomology 31: 551-560. https://doi.org/10.1590/S1519-566X2002000400007 Lomeli-Flores JR, Rodriguez-Rodriguez SE, Rodriguez-Levya E, Gonzalez-Hernandez H, Gariepy TD, Talamas EJ (2019) Field studies and molecular forensics identify a new as- sociation: Idris elba Talamas, sp. nov. parasitizes the eggs of Bagrada hilaris (Burmeister). In: Talamas E (Ed.) Advances in the Systematics of Platygastroidea H. Journal of Hymenoptera Research 73: 125-141. https://doi.org/10.3897/jhr.73.38025 Mahmood R, Jones WA, Bajwa BE, Rashid K (2015) Egg parasitoids from Pakistan as pos- sible classical biological control agents of the invasive pest Bagrada hilaris (Heteroptera: Pentatomidae). Journal of Entomological Science 50: 147-149. https://doi.org/10.18474/ JES14-28.1 Maneval H (1940) Fam. XVII. Proctotrypides. La Faune de la France en tableaux synoptiques illustres. Tome VII. Hymenopteres par Lucien Berland avec la collaboration de MM. Ray- mond Benoit, Francis Bernard, Henri Maneval. Chapter 27: 93-118. Mani MS (1941) Serphoidea. Catalogue of Indian Insects 26: 1-60. Mani MS, Mukerjee MK (1976) On some Baeinae (Proctotrupoidea: Scelionidae) from India. Oriental Insects 10: 497-526. https://doi.org/10.1080/00305316.1976.10434520 Mani MS, Sharma SK (1982) Proctotrupoidea (Hymenoptera) from India. A review. Oriental Insects 16: 135-258. https://doi.org/10.1080/00305316.1982.10434314 Marshall TA (1873) A catalogue of British Hymenoptera; Oxyura. Entomological Society of London, London 27 pp. Marshall TA (1892) Enumerations de quelques Hymenopteres du Venezuela. Bulletin de la Société Entomologique de France 1892: 60-76. Martel G, Augé M, Talamas E, Roche M, Smith L, Sforza RFH (2019) First laboratory evalu- ation of Gryon gonikopalense (Hymenoptera: Scelionidae), as potential biological control agent of Bagrada hilaris (Hemiptera: Pentatomidae). Biological Control 135: 48-56. htt- ps://doi.org/10.1016/j.biocontrol.2019.04.014 Martel G, Sforza RFH (2021) Catch me if you can: novel foraging behavior of an egg parasi- toid, Gryon gonikopalense, against the stinkbug pest, Bagrada hilaris. Journal of Pest Science 1-9. https://doi.org/10.1007/s10340-020-01325-4 A maximalist approach to the systematics of Gryon aetherium 47] Martel G, Scirpoli F, Sforza RFH (2021) How an egg parasitoid responds to an unusual stink- bug oviposition behavior: the case of Gryon gonikopalense Sharma (Hymenoptera: Scelioni- dae) and Bagrada hilaris (Burmeister) (Hemiptera: Pentatomidae). Entomologia Generalis in press. https://doi.org/10.1127/entomologia/2021/1256 Masner L (1958) A new egg-parasite of gipsy moth Lymantria dispar (L.). Entomophaga 3: 39-44. https://doi.org/10.1007/BF02372198 Masner L (1961) The genera Gryon Hal., /dris Foerst. and Hemisius Westw. (Hym., Scelioni- dae). Casopis Ceskoslovenské Spolecnosti Entomologické 58: 157-168. Masner L (1965) The types of Proctotrupoidea (Hymenoptera) in the British Museum (Natural History) and in the Hope Department of Entomology, Oxford. Bulletin of the British Muse- um (Natural History) Entomology Supplement 1: 1-154. https://doi.org/10.5962/p.97756 Masner L (1975) Two new sibling species of Gryon Haliday (Hymenoptera, Scelionidae), egg parasites of blood-sucking Reduviidae (Heteroptera). Bulletin of Entomological Research 65: 209-213. https://doi.org/10.1017/S0007485300005915 Masner L (1976) Revisionary notes and keys to world genera of Scelionidae (Hymenoptera: Proctotrupoidea). Memoirs of the Entomological Society of Canada 97: 1-87. https://doi. org/10.4039/entm10897fv Masner L (1979) ‘The variicornis-group of Gryon Haliday (Hymenoptera: Scelionidae). The Canadian Entomologist 11: 791-805. https://doi.org/10.4039/Ent111791-7 Masner L (1980) Key to genera of Scelionidae of the Holarctic region, with descriptions of new genera and species (Hymenoptera: Proctotrupoidea). Memoirs of the Entomological Society of Canada 113: 1-54. https://doi.org/10.4039/entm112113fv Masner L (1983) A revision of Gryon Haliday in North America (Hymenoptera: Proc- totrupoidea: Scelionidae). The Canadian Entomologist 115: 123-174. https://doi. org/10.4039/Ent1 15123-2 Masner L, Muesebeck CFW (1968) The types of Proctotrupoidea (Hymenoptera) in the United States National Museum. Bulletin of the United States National Museum 270: 1-143. https://doi.org/10.5479/si.03629236.270 Mayr G (1879) Ueber die Schlupfwespengattung Yélenomus. Verhandlungen der Zoologisch- Botanischen Gesellschaft in Wien 29: 697-714. Meier NF (1940) [Parasites reared in the USSR in 1938-1939 from eggs of the corn-bug (Eyv- rygaster integriceps Osch.).] Vestnik Zashchita Rastenii 3: 79-82. Meier NF (1949) [Toward knowledge of the species of egg-parasites of bugs found in recent years in the USSR.] Trudy Vsesoyuznogo Instituta Zashchity Rastenii 2: 114-116. Meier R, Blaimer BB, Buenaventura E, Hartop E, von Rintelen T, Srivathsan A, Yeo D (2021) A re-analysis of the data in Sharkey et al.’s (2021) minimalist revision reveals that BINs do not deserve names, but BOLDSystems needs a stronger commitment to open science. Cladistics 2021: 1-12. https://doi.org/10.1111/cla.12489 Miller MA, Pfeiffer W, Schwartz T (2010) Creating the CIPRES Science Gateway for infer- ence of large phylogenetic trees. Proceedings of the Gateway Computing Environments Workshop (GCE), 14 Nov. 2010, New Orleans, LA. pp. 1-8. https://doi.org/10.1109/ GCE.2010.5676129 Mineo G (1977) Studi morfo-biologici comparativi sugli stadi preimmaginali degli scelionidi (Hym. Proctotrupoidea). II. Su alcune specie del genere Gryon Haliday e Telenomus heydeni 472 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) Mayr. Bollettino dell’Istituto di Entomologia Agraria e dell’Osservatorio di Fitopatologia di Palermo 10: 81-94. Mineo G, Szabo JB (1978a) Studi sugli Scelionidae (Hym. Proctotrupoidea). H. Gryon delucchii sp. n., parassitoide oofago di Rhinocoris erythropus L. (Heter. Reduviidae). Bollettino del Laboratorio di Entomologia Agraria “Filippo Silvestri” Portici 35: 88-93. Mineo G, Szabé JB (1978b) Descriptions of two new Palearctic species of Gryon Haliday (Hy- menoptera: Scelionidae). Bollettino dell’Istituto di Entomologia Agraria e dell’ Osservatorio di Fitopatologia di Palermo 10: 113-120. Mineo G, Szabé JB (1978c) Two new scelionids: Gryon tico and Gryon discolor (Hym. Proc- totrupoidea). Bollettino del Laboratorio di Entomologia Agraria “Filippo Silvestri” Portici 35: 94-98. Mineo G, Szabé JB (1979) Scelionids from Tunisia (Hymenoptera: Scelionidae). Annales His- torico-Naturales Musei Nationalis Hungarici. 71: 271-272. Mineo G (1979a) Studies of the Scelionidae (Hym. Proctotrupoidea). [X. Material for a revision of the genus Gryon Hal., with description of 4 new species (G. austrafricanum, G. eremi- ogryon, G. laraichii, G. nicolai) and notes on other scelionids. Bollettino del Laboratorio di Entomologia Agraria “Filippo Silvestri” Portici 36: 234-265. Mineo G (1979b) Studi sugli scelionidi (Hymenoptera, Proctotrupoidea): VII. Sulle specie paleartiche del genere Gryon Haliday parassite di Aelia ed Eurygaster spp. (Heteroptera, Pentatomidae). Naturalista Siciliano 3: 91-97. Mineo G (1979c) Gryonini from Mongolia (Hymenoptera, Scelionidae). Annales Historico- Naturales Musei Nationalis Hungarici 71: 267-270. Mineo G (1980a) Studi Sugli Scelionidae (Hym. Proctrupoidea). X. Materiale per una revisione del genere Gryon Haliday: osservazioni su specie note, nuove sinonimie e descrizione del maschio di Gryon dichropterus Kozlov. Bollettino dell’Istituto di Entomologia Agraria e dell’ Osservatorio di Fitopatologia di Palermo 10: 189-203. Mineo G (1980b) Studies on the Scelionidae (Hym. Proctotrupoidea). XI. A revision of the Palearctic species of Gryon Haliday: the insulare and pubescens groups. Bollettino dell’Istituto di Entomologia Agraria e dell’ Osservatorio di Fitopatologia di Palermo 10: 213-226. Mineo G (1981) Studies on the Scelionidae (Hym. Proctotrupoidea) XIII. A revision of the Palearctic species of Gryon Haliday: the muscaeformis group. Redia 64: 117-147. Mineo G (1982a) Studies on the Scelionidae (Hym. Proctotrupoidea) XV. World distribution of Maruzza gen. n. Bollettino del Laboratorio di Entomologia Agraria “Filippo Silvestri” Portici 39: 163-174. Mineo G (1982b) Studies on the Scelionidae (Hym. Proctotrupoidea) XVII. Material for a revision of the genus Gryon Hal. (Ethiopian region) with descriptions of three new species (G. kenyotum, G. paracharontis and G. urum). Redia 65: 303-313. Mineo G (1983a) Studies on the Scelionidae (Hym. Proctotrupoidea) XVUI. Revision of the genus Gryon Hal. (Ethiopian-Oriental regions): the charon-group. Phytophaga 1: 11-26. Mineo G (1983b) Studies on the Scelionidae (Hymenoptera) XIX. A revision of the Ethiopian species of Gryon Haliday: the pubescens-group. Annales Historico-Naturales Musei Nation- alis Hungarici 75: 285-293. Mineo G (1983c) Studies on the Scelionidae (Hym. Proctotrupoidea) XX. Revision of the genus Gryon Haliday (Ethiopian region): the insulare and oculatum-groups. Redia 66: 527-552. A maximalist approach to the systematics of Gryon aetherium 473 Mineo G (1990a) Studies on the Scelionidae (Hym. Proctotrupoidea) XXV. Material for a revision of Gryon Haliday with description of six new species: Gryon crassifemoratum, G. gryonis, G. minimum, G. pecki, G. scorsonis and G. sulawense. Frustula Entomologica 11: 171-188. Mineo G (1990b) Studies on the Scelionidae (Hym, Proctotrupoidea) XXVI. Material for a revision of Gryon Hal. with description of a new species: Gryon risbeci. Frustula Entomo- logica 12: 47-59. Mineo G (1990c) Studies on the Scelionidae (Hym. Proctotrupoidea) XXXII. Revision of the Ethiopian-Oriental regions of Gryon Haliday: the /etus-group. Frustula Entomologica 13: 89-92. Mineo G (1991) Description of new species of Gryon Haliday (Hym., Scelionidae). Frustula Entomologica 14: 1-42. Mineo G (1992) New species of Gryon Haliday (Hym. Scelionidae). Phytophaga 4: 17-28. Mineo G (2004) Description of new taxa, both in Scelioninae and Telenominae (Hymenoptera Scelionidae). Bollettino di Zoologia Agraria e Bachicoltura 36: 173-188. Mineo G, Caleca V (1987a) Remarks on the species of Gryon Haliday of the floridanum-group with description of a new species (Hym. Proctotrupoidea: Scelionidae). Phytophaga 2: 31-39. Mineo G, Caleca V (1987b) World revision of four small groups of Gryon Haliday: the artum, the austrafricanum, the hospes and the misellum (Hym., Proctotrupoidea, Scelionidae). Phy- tophaga 2: 41-55. Mineo G, Caleca V (1994) New data on some scelionid wasps and description of new species. Phytophaga 5: 113-135. Mineo G, Gatto A (1981) Studi morfo-biologici comparativi sugli stadi preimmaginali degli scelionidi (Hym. Proctotrupoidea). V. Observazioni su Gryon delucchii Mineo & Szabo. Redia 64: 187-190. Mineo G, Villa L (1982a) The morphology of the back of the head of Gryonini (Hym. Proc- totrupoidea, Scelionidae). Bollettino del Laboratorio di Entomologia Agraria “Filippo Sil- vestri” Portici 39: 133-162. Mineo G, Villa L (1982b) Preliminary study on pleural morphology, clypeus and some anten- nal sensilla of Gryonini (Hym. Proctotrupoidea, Scelionidae). Bollettino del Laboratorio di Entomologia Agraria “Filippo Silvestri” Portici 39: 175-202. Minh BQ, Schmidt HA, Chernomor O, Schrempf D, Woodhams MD, von Haeseler A, Lanfear R (2020) IQ-TREE 2: New models and efficient methods for phylogenetic inference in the genomic era. Molecular Biology and Evolution 37: 1530-1534. https://doi.org/10.1093/ molbev/msaa015 Mokrzecki Z, Ogloblin AA (1931) Hadronotus howardi n. sp. (Microhymenopt., Proctotrupi- dae). Polskie Pismo Entomologiczne 10: 1-7. Morley C (1929) Catalogus Oxyurarum Britannicorum. Transactions of the Suffolk Naturalists’ Society 1: 39-60. Motschoulsky V de (1863) Essai d’un catalogue des insectes de l’ile Ceylan. Bulletin de la So- ciété Imperiale des Naturalistes de Moscou 36: 1-153. Muesebeck CFW (1979) Superfamily Proctotrupoidea. Catalog of Hymenoptera in America north of Mexico. Volume 1. Symphyta and Apocrita (Parasitica). 1121-1186. 474 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) Muesebeck CFW, Masner L (1967) Superfamily Proctotrupoidea. Hymenoptera of America north of Mexico. Synoptic Catalog (Agriculture Monograph No. 2). Second supplement. pages 285-304. Muesebeck CFW, Walkley LM (1951) Superfamily Proctotrupoidea. Hymenoptera of America north of Mexico — Synoptic Catalog. 655-718. Naumann ID, Cardale JC, Taylor RW, MacDonald J (1994) Type specimens of Australian Hy- menoptera (Insecta) transferred from the Macleay Mueseum, University of Sydney, to the Australian National Insect Collection, Canberra. Proceedings of the Linnean Society of New South Wales 114: 69-72. Nees von Esenbeck CG (1834) Hymenopterorum ichneumonibus affnium monographiae, genera europaea et species illustrantes. Vol. 2. J. G. Cotta, Stuttgart 448 pp. https://doi. org/10.5962/bhl.title.26555 Nixon GE]J (1934a) New Javanese species of Hadronotus (Hym., Proct., Scelioninae). Stylopa 3: 1-5. https://doi.org/10.1111/j.1365-3113.1934.tb01520.x Nixon GEJ (1934) The African species of Hadronotus (Hymenoptera, Proctotrupoidea, Sub- fam. Scelioninae). Annals and Magazine of Natural History 14: 290-313. https://doi. org/10.1080/00222933408654897 Nixon GEJ (1936) The African species of Teleasinae (Hym., Proctotrupoidea, Fam. Scelioni- dae). Annals and Magazine of Natural History 17: 114-191. https://doi.org/10.1080/037 45481.1936.10801393 O’Connor JP, Nash R, Notton DG, Fergusson NDM (2004) A catalogue of the Irish Platygas- troidea and Proctotrupoidea (Hymenoptera). Occasional Publication of the Irish Biogeo- graphical Society 7: 1-110. Ozdikmen H (2011) New names for some preoccupied specific epithets in the families Cer- aphronidae, Diapriidae and Platygastridae (Hymenoptera: Parasitica). Munis Entomology & Zoology 6: 769-778. Palumbo JC, Natwick ET (2010) The bagrada bug (Hemiptera: Pentatomidae): a new invasive pest of cole crops in Arizona and California. Plant Health Progress 11(1): 1-3. https://doi. org/10.1094/PHP-2010-0621-01-BR Palumbo JC, Perring TM, Millar J, Reed DA (2016) Biology, ecology, and management of an invasive stink bug, Bagrada hilaris, in North America. Annual Review of Entomology 61: 453-473. https://doi.org/10.1146/annurev-ento-010715-023843 Park J, Foighil DO (2000) Sphaeriid and corbiculid clams represent separate heterodont bi- valve radiations into freshwater environments. Molecular Phylogenetics and Evolution 14: 75-88. https://doi.org/10.1006/mpev.1999.0691 Pentinsaari M, Salmela H, Mutanen M, Roslin T (2016) Molecular evolution of a widely- adopted taxonomic marker (COI) across the animal tree of life. Scientific Reports 6: e35275. https://doi.org/10.1038/srep35275 Peter A, Rajmohana K (2014) A new species of Gryon Haliday (Hymenoptera: Platygastridae) from India. Journal of Threatened Taxa 6: 67 11-6714. https://doi.org/10.11609/JoT'T.03903.6711-4 Picard F (1924) Description d’un nouveau Proctotrypide du genre Hadronotus [Hym.]. Bul- letin de la Société Entomologique de France 1924: 107-109. https://doi.org/10.3406/ bsef.1924.27321 Pintureau B, al-Nabhan M (2003) New data on the European species of three genera Scelioni- dae (Hymenoptera). Zootaxa 238: 1-12. https://doi.org/10.11646/zootaxa.238.1.1 A maximalist approach to the systematics of Gryon aetherium 475 Popovici OA, Johnson NF (2012) Gross anatomy of the Malpighian tubules and internal male genitalia of Scelioninae (Hymenoptera; Platygastroidea; Platygastridae) with phylogenetic implications. Proceedings of the Entomological Society of Washington 114: 372-397. https://doi.org/10.4289/0013-8797.114.3.372 Priesner H (1951) New genera and species of Scelionidae (Hymenoptera, Proctotrupoidea) from Egypt. Bulletin de l'Institut Fouad I du Desert 1: 119-149. Rajmohana K (2006) Studies on Proctotrupoidea and Platygastroidea (Hymenoptera: Insecta) of Kerala. Memoirs of the Zoological Survey of India 21: 1-153. https://doi.org/10.11609/ JoTT.ZPJ.1570.2506-13 Rajmohana K (2014) A systematic inventory of Scelioninae and Teleasinae (Hymenoptera: Platygastridae) in the rice ecosystems of north-central Kerala. Memoirs of the Zoological Survey of India 22: 1-72. Rambaut A (2012) Fig Tree, version 1.4.3. Computer program distributed by the author. Web- site: http://tree.bio.ed.ac.uk/software/figtree/. Ratnasingham S, Hebert PDN (2003) A DNA-based registry for all animal species: The Bar- code Index Number (BIN) system. PLoS ONE 8(8): e66213. https://doi.org/10.1371/ journal.pone.0066213 Ratnasingham S, Hebert PDN (2007) BOLD: The Barcode of Life Data System (http://www. barcodinglife.org). Molecular Ecology Notes 7: 355-364. https://doi.org/10.1111/j.1471- 8286.2007.01678.x Reed DA, Palumbo JC, Perring TM, May C (2013) Bagrada hilaris (Burmeister), an invasive stink bug attacking cole crops in the southwestern United States. Journal of Integrated Pest Management 4: 1-7. https://doi.org/10.1603/IPM13007 Risbec J (1950) Contribution a l’étude des Proctotrupidae (Serphiidae). Travaux du Laboratoire d’Entomologie du Secteur Soudanis de Recherches Agronomiques. Chapter 2, 511-639. Risbec J (1955) Hymenopteres parasites du Cameroun. Bulletin de l'Institut Francais d’ Afrique Noire 17: 191-266. Risbec J (1956) Proctotrupides Scelionini de Madagascar [Hymenopteres]. Revue Francaise d’Entomologie 23: 244-264. Risbec J (1957) Contributions a letude de la faune entomologique du Ruanda-Urundi (Mision P. Basilewsky 1953). CXXII. Hymenoptera Proctotrupidae. Annales du Musée Royal du Congo Belge Tervuren (Belgique), Serie in-8°, Sciences Zoologiques 58: 137-147. Risbec J (1958) Contributions 4 la connaissance de Hyménoptéres Chalcidoides et Proc- totrupoides de |’Afrique Noire. IV. Prototrupoides du Congo Belge. Annales du Musée Royal du Congo Belge Tervuren (Belgique), Serie in-8°, Sciences Zoologiques 64: 106-138. Rojas-Galvez NR, Talamas E, Albornoz MV, Flores MF, Barros-Parada W, Bout A (2021) Gryon aetherium Yalamas (Hymenoptera, Scelionidae): Parasitoid of Bagrada hilaris (Burmeister) (Hemiptera, Pentatomidae) Adventive in Chile. In: Lahey Z, Talamas E (Eds) Advances in the Systematics of Platygastroidea HI. Journal of Hymenoptera Research 87: 493-501. https://doi.org/10.3897/jhr.87.75363 Ryakhovskii VV (1959) [Egg parasites of the sunn pest in the Ukrainian SSR.] Ukrainskii Nauchno-Issledovatel’skii Institut Zashchity Rastenii 8: 76-88. Sabbatini Peverieri G, Talamas E, Bon MC, Marianelli L, Bernardinelli I, Malossini G, Benv- enuto L, Roversi PF, Hoelmer K (2018) Two Asian egg parasitoids of Halyomorpha halys 476 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) (Stal) (Hemiptera, Pentatomidae) emerge in northern Italy: Trissolcus mitsukurii (Ashmead) and Trissolcus japonicus (Ashmead) (Hymenoptera, Scelionidae). Journal of Hymenoptera Research 67: 37-53. https://doi.org/10.3897/jhr.67.30883 Safavi M (1968) Etude biologique et ecologique des hymenopteres parasites des oeufs des pu- naises de cereales. Entomophaga 13: 381-495. Sanchez-Pefa SR (2014) First record in Mexico of the invasive stink bug Bagrada hilaris, on cultivated crucifers in Saltillo. Southwestern Entomologist 39: 375-377. https://doi. org/10.3958/059.039.0219 Sarazin MJ (1986) Primary types of Ceraphronoidea, Evaniodea, Proctotrupoidea, and Trigona- loidea (Hymenoptera) in the Canadian National Collection. The Canadian Entomologist 118: 957-989. https://doi.org/10.4039/Ent118957-10 Sforza RFH, Bon MC, Martel G, Augé M, Roche M, Mahmood R, Smith L (2017) Initial evaluation of two native egg parasitoids for the control of Bagrada hilaris, an invasive stink bug in western USA. Symposium on Biological Control of Arthropods 221-223. https:// doi.org/10.1079/9781786394118.0221 Sharkey MJ, Janzen DH, Hallwachs W, Chapman EG, Smith MA, Dapkey T, Brown A, Rat- nasingham S, Naik S, Manjunath R, Perez K, Milton M, Hebert P, Shaw SR, Kittel RN, Solis MA, Metz MA, Goldstein PZ, Brown JW, Quicke DLJ, van Achterberg C, Brown BV, Burns JM (2021) Minimalist revision and description of 403 new species in 11 subfamilies of Costa Rican braconid parasitoid wasps, including host records for 219 species. ZooKeys 1013: 1-665. https://doi.org/10.3897/zookeys. 1013.55600 Sharma SK (1982) On some Scelionidae (Proctotrupoidea: Hymenoptera) from India. Records of the Zoological Survey of India 79: 319-342. Simon C, Frati FE Beckenbach A, Crespi B, Liu H, Flook P (1994) Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved poly- merase chain reaction primers. Annals of the Entomological Society of America 87: 651- 701. https://doi.org/10.1093/aesa/87.6.651 Simons EE, Reardon RC, Ticehurst M (1974) Selected parasites and hyperparasites of the gypsy moth, with keys to adults and immatures. U.S. Dept. Agric. Agric. Handbk. No. 540 58 pp. Stahl J, Tortorici F Pontini M, Bon M-C, Hoelmer K, Marazzi C, Tavella L, Haye T (2019) First discovery of adventive populations of Trissolcus japonicus in Europe. Journal of Pest Science 92: 371-379. https://doi.org/10.1007/s10340-018-1061-2 Stark JD, Banks JE (2003) Population-level effects of pesticides and other toxicants on ar- thropods. Annual Review of Entomology 48: 505-519. https://doi.org/10.1146/annureyv. ento.48.091801.112621 Subba Rao BR, Chacko MJ (1962) Three new species of Hadrophanurus Kieffer from India with a key to species (Hymenoptera: Scelionidae). Beitrige zur Entomologie 476-484. Sundholm A (1967) Prosacantha Nees, sensu Thomson, selection of lectotypes (Hym. Proct. Scelionidae). Opuscula Entomologica 32: 131-134. Sundholm A (1970) Hymenoptera: Proctotrupoidea. South African Animal Life 14: 305-401. Szabé JB (1966) Oekologische, ethologische, tiergeographische und systematische Untersu- chungen an palaearktischen Gryoninen (Hymenoptera: Proctotrupoidea, Scelionidae). Acta Zoologica Academiae Scientiarum Hungaricae 12: 419-449. A maximalist approach to the systematics of Gryon aetherium 477 Taekul C, Valerio AA, Austin AD, Klompen H, Johnson NF (2014) Molecular phylogeny of telenomine egg parasitoids (Hymenoptera: Platygastroidea s.].: Telenominae): evolution of host shifts and implications for classification. Systematic Entomology 39: 24-35. https:// doi.org/10.1111/syen.12032 Talamas EJ, Buffington ML (2015) Fossil Platygastroidea in the National Museum of Natural History, Smithsonian Institution. Journal of Hymenoptera Research 47: 1-52. https://doi. org/10.3897/JHR.47.5730 Talamas E, Bufhngton M, Hoelmer K (2017a) Revision of Palearctic Trissolcus Ashmead (Hy- menoptera: Scelionidae). In: Talamas EJ, Buffington ML (Eds) Advances in the Systematics of Platygastroidea. Journal of Hymenoptera Research 56: 3-185. Talamas EJ, Thompson J, Cutler A, Fitzsimmons Schoenberger S, Cuminale A, Jung T, Johnson NE, Valerio AA, Smith AB, Haltermann V, Alvarez E, Schwantes C, Blewer C, Bodenreider C, Salzberg A, Luo P, Meislin D, Buffington ML (2017b) An online photographic catalog of primary types of Platygastroidea (Hymenoptera) in the National Museum of Natural History, Smithsonian Institution. In: Talamas EJ, Buffington ML (Eds) Advances in the Systematics of Platygastroidea. Journal of Hymenoptera Research 56: 187-224. Talamas EJ, Pham H-T (2017) An online photographic catalog of Platygastroidea (Hymenoptera) in the Institute of Ecology and Biological Resources (Hanoi, Vietnam), with some taxonomic notes. In: Talamas EJ, Buffington ML (Eds) Advances in the Systematics of Platygastroidea. Journal of Hymenoptera Research 56: 225-239. https://doi-org/10.3897/jhr.56.10214 Talamas EJ, Bon M-C, Hoelmer KA, Buffington ML (2019) Molecular phylogeny of Trissolcus wasps (Hymenoptera, Scelionidae) associated with Halyomorpha halys (Hemiptera, Pen- tatomidae). In: Talamas E (Eds) Advances in the Systematics of Platygastroidea II. Journal of Hymenoptera Research 73: 201-217. https://doi.org/10.3897/jhr.73.39563 Taylor ME, Bundy CS, McPherson JE (2014) Unusual ovipositional behavior of the stink bug Bagrada hilaris (Hemiptera: Heteroptera: Pentatomidae). Annals of the Entomological So- ciety of America 107: 872-877. https://doi.org/10.1603/AN 14029 Thomson CG (1859) Sveriges Proctotruper. Tribus VII. Scelionini. Ofversigt af Kongliga Vet- enskaps-Akadamiens Forhandlingar 15: 417-431. Timokhov, AV (2019a) New data and corrections to the fauna of scelionid wasps (Hymenop- tera: Scelionidae) of Russia. Proceedings of the Russian Entomological Society 90: 13-21. https://doi.org/10.47640/1605-7678_2019_90_13 Timokhov, AV (2019b) Superfamily Platygastroidea. In: Belokobylskij SA, Samartsev KG, IPinskaya AS (Eds) Annotated Catalogue of the Hymenoptera of Russia (Vol. 2). Apocrita: Parasitica. Proceedings of the Zoological Institute Russian Academy of Sciences. Suppe- ment 8. Zoological Institute RAS, St. Petersburg, 42-57. Tofangsazi N, Hogg BN, Hougardy E, Stokes K, Pratt PD (2020) Host searching behavior of Gryon gonikopalense and Trissolcus hyalinipennis (Hymenoptera: Scelionidae), two candidate biological control agents for Bagrada hilaris (Hemiptera: pentatomidae). Biological Control 151: €104397. https://doi.org/10.1016/j.biocontrol.2020.104397 Tortorici F, Caleca V, van Noort S, Masner L (2016) Revision of Afrotropical Dyscritobaeus Per- kins, 1910 (Hymenoptera: Scelionidae). Zootaxa 4178: 1-59. https://doi.org/10.11646/ zootaxa.4178.1.1 478 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) Veenakumari K, Rajmohana K, Mohanraj P, Peter A (2016) An unusual, new, sexually dimor- phic species of Gryon Haliday (Hymenoptera: Scelionidae) from India. Oriental Insects 50: 40-49. https://doi.org/10.1080/00305316.2016.1142482 Viggiani G, Mineo G (1974) Identificazione dei parassitoidi del Gonocerus acuteangulatus (Goeze). Bollettino dell’ Istituto di Entomologia Agraria e dell’Osservatorio di Fitopatolo- gia di Palermo 8: 143-163. Vlug HJ (1995) Catalogue of the Platygastridae (Platygastroidea) of the world (Insecta: Hyme- noptera). Hymenopterorum Catalogus 19: 1-168. Walker F (1836) On the species of Teleas, &c. Entomological Magazine 3: 341-370. Walker F (1839) Monographia Chalciditum. Vol. I]. Hyppolite Bailliere, London, 100 pp. https://doi.org/10.5962/bhl.title.67725 Walker F (1874) Notes on the Oxyura. — Family 2. Scelionidae. The Entomologist 70: 4—10. Watanabe C (1951) On five scelionid egg-parasites of some pentatomid and coreid bugs from Shikoku, Japan (Hymenoptera: Proctotrupoidea). Transactions of the Shikoku Entomo- logical Society 2: 17-26. Westwood JO (1840) Synopsis of the genera of British Insects. Longman, Orme, Brown, Green, and Longmans, London 158 pp. Whiting ME, Carpenter JC, Wheeler QD, Wheeler WC (1997) The Strepsiptera Problem: Phy- logeny of the Holometabolous Insect Orders Inferred from 18S and 28S Ribosomal DNA Se- quences and Morphology. Systematic Biology 46: 1-68. https://doi.org/10.1093/sysbio/46.1.1 Wollaston TV (1858) Brief diagnostic characters of undescribed Madeiran insects. Annals and Magazine of Natural History 1: 18-125. https://doi.org/10.1080/00222935808696865 Yoder MJ, Miko I, Seltmann KC, Bertone MA, Deans AR (2010) A gross anatomy ontol- ogy for Hymenoptera. PLoS ONE 5(12): e15991. https://doi.org/10.1371/journal. pone.0015991 Supplementary material | GenBank accession number Authors: Matthew R. Moore Data type: Docx file. Explanation note: Taxon sampling for multi-gene analysis and GenBank accession number. Copyright notice: This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODDbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited. Link: https://doi.org/10.3897/jhr.87.72842.suppl1 A maximalist approach to the systematics of Gryon aetherium 479 Supplementary material 2 Sequence data Authors: Matthew R. Moore Data type: Txt file. Explanation note: Annotated COI amino acid sequences from exemplar scelionids. Copyright notice: This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODDbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited. Link: https://doi.org/10.3897/jhr.87.72842.suppl2 Supplementary material 3 Phylogenetic tree Authors: Matthew R. Moore, Zachary Lahey, Elijah J. Talamas Data type: Png file. Explanation note: Maximum likelihood tree of scelionid COI data. Copyright notice: This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODDbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited. Link: https://doi.org/10.3897/jhr.87.72842.supp13 Supplementary material 4 Table Authors: Elijah J. Talamas Data type: Xs file. Explanation note: This table lists the morphological terms used in this publication and their associated concepts in the Hymenoptera Anatomy Ontology. Copyright notice: This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODDbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited. Link: https://doi.org/10.3897/jhr.87.72842.suppl4 480 Elijah J. Talamas et al. / Journal of Hymenoptera Research 87: 323-480 (2021) Supplementary material 5 BOLD BINs Authors: Elijah J. Talamas Data type: Docx file. Explanation note: BOLD BINs included in COI barcode analyses with their respective taxon identifications. Copyright notice: This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODDbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited. Link: https://doi.org/10.3897/jhr.87.72842.suppl5