Biodiversity Data Journal 11: e99224 CO) doi: 10.3897/BDJ.11.e99224 open access Research Article Diversity of culturable thermophilic bacteria from Tata Pani hotspring of Kotli Azad Jammu and Kashmir Kazima Ishaq*, Asad Hussain Shah§, Anila Fariq*, Sajida Rasheed*, Sammyia Jannat* + Department of Biotechnology, Faculty of Basic and Applied Sciences, University of Kotli Azad Jammu and Kashmir, Kotli, Pakistan § Senior Research Fellow, Faculty of Biology Medicine and Health The University of Manchester The Michael Smith Building Oxford Road Manchester M13 9PT, Manchester, United Kingdom Corresponding author: Asad Hussain Shah (asad.shah@manchester.ac.uk) Academic editor: Anna Sandionigi Received: 23 Dec 2022 | Accepted: 28 Feb 2023 | Published: 14 Mar 2023 Citation: Ishaq K, Shah AH, Farig A, Rasheed S, Jannat S (2023) Diversity of culturable thermophilic bacteria from Tata Pani hotspring of Kotli Azad Jammu and Kashmir. Biodiversity Data Journal 11: e99224. https://doi.org/10.3897/BDJ.11.e99224 Abstract Hot water springs are unique areas populated by mesophiles, thermotolerant and hyperthermophiles. They are the source of diversity of thermophiles, mainly belonging to archaea and bacteria domains. The diversity of thermophiles gives an outline of the huge biological potential that can be exploited for industrial applications.To this end, this study was aimed to isolate and characterise the unexplored thermophilic microorganisms from hot water spring in Tatapani, Tehsil & District Kotli AJK, Pakistan. Around 10 bacterial isolates were identified using morphological, biochemical, physiological and molecular attributes. Sequencing of the 16S rDNA gene of the isolates followed by BLAST search revealed that the strain MBT008 has 100% similarity with Anoxybacillus kamchatkensis. MBT012 showed 99.57% similarity with A. mongoliensis, MBT014 was affiliated with A. tengchongensis with 99.43% similarity, MBT009 showed 99.83% homology with A. gonensis and MBT018, 98.70% similarity with A. karvacharensis. The presence of all this microbial diversity in one common source is of immense importance related to envioronmental and industrial aspects in general and extraction of thermostable enzymes from these thermophiles specifically opens new horizons in the field of industrial © Ishaq K et al. This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. 2 Ishaq K et al biotechnology. These thermophiles are revealing new capabilities and are being manipulated by biotechnologists in utilizing them in different unique ways. Keywords Hot water springs, thermophiles, diversity, bacteria, archaea, 16S rDNA Materials and methods Sample collection A total of ten water/sediment samples from 10 different locations separated by a distance of approximately 1.0 ft (0.3 m) were collected from different locations of the hot water spring of Tatapani (District Kotli) in sterilised screw-capped bottles and were carried to the laboratory of Biotechnology and _ processed immediately. The physiochemical characteristics of the hot water spring was examined. The electrical conductivity was monitored by using an EC meter and pH of water samples was measured using a pH meter. Isolation of thermophilic strains The sediment and water samples were incubated at 70°C overnight in nutrient broth medium for the isolation of thermophiles. The growth was observed by analysing the turbidity of the growth medium. Next day, the suspended cultures were poured by spread plate technique on the agar plates for the isolation of the mixed population of microorganisms. For calculating the colonyforming unit of viable bacterial cells, several serial dilutions were made in 1:10 ratios. From these dilutions, 0.1 ml was plated on to nutrient agar and, after 24 hours incubation, colonies were observed and counted on the plate. The number of bacteria (CFU) per millilitre of sample was calculated by dividing the number of colonies by the dilution factor. To purify bacterial colonies, single colony streaking is done by picking individual colonies with a sterilised inoculation loop and touching it iton to the nutrient agar plate. Morphological characterisation Colony morphology like colour, shape, elevation and texture of pure bacterial cultures obtained through single colony streaking was observed visually as well as examined under the microscope. Gram’s staining was performed to differentiate bacteria according to cell wall composition through a series of staining and decolourisng steps. Growth conditions optimisation Growth conditions were optimised for pH, temperature, inoculum size and incubation time. Temperature range for incubation varied from 40, 50, 60, 70 and 80°C and the pH dependence of growth was tested in the pH range of 6.0-9.0 in nutrient broth medium, while the effect of varied incubation time intervals for these thermophiles’ growth was noted Diversity of culturable thermophilic bacteria from Tata Pani hotspring ... 3 for 24 hours, 48 hours and 72 hours. The growth was also monitored at different inoculum size i.e. 25 ul, 50 ul, 75 ul and 100 ul. The optical density in all conditions was measured to measure the growth of strains at 600 nm on a double beam UV/VIS_ scanning spectrophotometer (Model: AE-S90-MD). Biochemical characterisation For biochemical characterisation, API 20E strips were used to examine the isolates for numerous substrates utilisation like adonitol, glycerol, D-arabinose, erythritol, L-arabinose, D-xylose, L-xylose, ribose, B-methyl xyloside, mannose, glucose, L-sorbose, dulcitol, rhamnose, inositol, mannitol, sorbitol, _D-methyl-D-glucoside, amygdalin, N- acetylglucosamine, aesculin, arbutin, salicin, maltose, cellobiose, lactose, trehalose, sucrose, melibiose, raffinose, starch, glycogen, D-turanose, D-fucose, inulin, L-fucose, D- arabitol, D-lyxose, L-arabitol, gluconate, 2,5-ketogluconate and xylitol. Suspended bacterial cultures (100 ul) grown for 24 hours in 0.8% sterilised saline solution were injected into the wells of strips containing the substrate and incubated at 70°C for 24 hours. The colour change was studied according to kit instructions. After the incubation period, all the results were recorded and then revealed the tests which require the addition of reagents. The presence of oxidase and catalase enzymes was examined according to the procedures designed by Prescott et al. (1997). Antibiotic Sensitivity The sensitivity profiles of the bacteria isolated from water/sediment samples against various antibiotics like ciprofloxacin, levofloxacin, azithromycin, cefixime, linezolid etc. was also done by the disc diffusion method. DNA extraction and amplification of the 16S rDNA gene Genomic DNA was extracted from bacteria consistent with the protocol described by Cheng and Jiang (2006). The 16S rDNA gene amplification from the purified genomic DNA was performed in 0.2 ml PCR tubes with 20 ul reaction volume using the forward primer 27F AGAGTTTGATCCTGGCTCAG and the reverse primers 1492R TACGGCTA CCTTGTTACGACTT and all the PCR amplifications were carried out by using a thermal cycler (Model: TC-TE). Sequencing analysis After amplification, the PCR products obtained were sequenced by using same upstream and downstream primers, by a commercial sequencing facility i.e. MacroGen. The entire 16S rDNA sequences of these bacterial strains obtained were blasted using the online NCBI BLAST programme (Waterhouse et al. 2009). Phylogenetic analyses were done to express evolutionary associations of these isolates. The analysis started with aligning of sequences by the Clustal W tool and after alignment, the phylogenetic tree was built using MEGAX software. 4 Ishaq K et al Introduction Hot springs comprise of the environment with high temperature ranges and formed due to geothermal movement and are host to variety of thermophiles (Zhang et al. 2004, Yohandini et al. 2015). A hydrothermal spring is characterised by warm groundwater which is heated by intense geothermal heat, the indispensable heat beneath the Earth’s surface. The life in hot springs started long before reaching the surface and the hot water serves as a habitat for large number of bacteria and algae which were then termed as thermophiles (Adiguzel et al. 2009). These thermophilic microorganisms prefer to grow at high temperature which normally does not exist in nature. Thermophilic microorganisms were the first living organisms which develop and evolve in the ancient days when the Earth’s surface temperature was relatively high, so they were called the “Universal Ancestor’ (Kumar 2010). Moreover, a study of thermophiles resulted in the discovery of novel species (Kozina et al. 2010). Thermophiles are characterised into moderate (optimum temperature, 55—60°C), extremophiles (optimum temperature, 60-80°C) and hyperthermophiles (optimum temperature, 80—110°C) (Saha et al. 2005). Nowadays, extremophilic microorganisms with their different classes, thermophiles, alkaliphiles, acidophiles, halophiles and psychrophiles, attracted the attention of many researchers in various areas, because of their capability to resist and perform life functions under extreme environmental conditions (Tango and Islam 2010). Due to their potential to produce thermostable enzymes (like DNA polymerases, chitinases, cellulases, amylases, pectinases, proteases, lipases and xylanases), thermophilic bacteria have attained great consideration amongst extremophiles. These thermostable enzymes are more stable and possess unique characteristics that make them appropriate for performing biotechnological procedures at higher temperatures (Singh et al. 2011). The earliest thermophilic spores forming bacteria capable of surviving at 70°C were discovered by Miquel in 1888 for the first time (Miquel 1888). Since that, numerous spore forming strains of thermophilic bacteria, mainly related to Bacillus and Clostridium genera, have been characterised (Maugeri et al. 2001, Belduz et al. 2003). Thermophiles have attracted the attention of many scientists for their potential in biotechnological processes (Adiguzel et al. 2009). These thermophilic bacteria have been characterised phenotypically and genotypically in particular from many hot springs in different regions of the world, including Turkey (Gul-Guven et al. 2008), Bulgaria (Derekova et al. 2008), Italy (Maugeri et al. 2001), China (Poli et al. 2009), Greece (Sievert et al. 2000 , Lau et al. 2008), Iceland (Takacs et al. 2001) and India (Sharma et al. 2008). Due to development in techniques of molecular biology, such as gene sequencing of 16S rRNA, tremendous opportunities have become available for identifying and characterising microbes at species level. In recent times, the bio-chemical and molecular characterisation of thermophilic microorganisms from geothermal springs has been reported to explain the mechanism and Diversity of culturable thermophilic bacteria from Tata Pani hotspring ... 5 molecular cause of the adaptation of these organisms to extreme temperature (Panda et al. 2016). Tatapani is situated in Kotli, Azad Kashmir (Pakistan) at a latitude and longitude of 33.60 N, 73.94 E, respectively and TattaPani hot springs are located on the right bank of Poonch River as shown in Fig. 1 and can be reached from Kotli by covering a distance of 26 km. The hot spring of Tatapani has been known for its flowing hot water on the western bank of Poonch River at an elevation of 682 m (2,237 ft). Due to its exclusive hot water, it attracts the attention of tourists who benefit from its steam in winter. Locals and tourists enjoy this hot water bath which is rich in sulphur. The water is believed to have high medical value and good for the skin. However, the microbial diversity of this very unique repository of microorganisms has not been explored. The tremendous capability of such important bacterial strains can be a substantial source of thermostable enzymes. @ Study Site f == Poonch River Mahasheer Nationa! Park & |__| Study Area Elevation Mirpur Value 205 - 500 HE 500 - 1,000 HE 1.000 - 1,500 HE 1.500 - 2,194 Figure 1. EES] Map of the hot spring Tatapani, AJK, Pakistan. 34 Kilometers Tatapani hot spring has not yet been explored from the microbiological characteristics. The specific purpose of this study was to identify and characterise the bacterial strains from the hot water spring of Tatapani by using various morphological markers and to carry out the biochemical and molecular characterisation of the isolated bacteria. Due to limited scientific knowledge existing on the research being done in this field and to explore this unseen and under-utilised source of thermostable bacteria, this study was performed to isolate and characterise the thermophilic microorganisms from various locations of the hotwater spring situated in Tatapani, District Kotli AJK, Pakistan. The advancement of the scientific information regarding the biodiversity of these delicate ecosystems underlines the requirement for their preservation; in addition, this microbial diversity possibly will be the basis for further biotechnological utilizations representing an important keystone for a developing region. 6 Ishaq K et al Results Isolation and Characterisation of the Samples In this study, the hot spring represented a moderate to high temperature (39.9—75°C) and neutrophilic to alkalophilic (pH 7.03—8.6) environment with varying electrical conductivity (0.51— 3.27 pscm-'). After enrichment, visible turbidity was observed in almost all samples within 24 to 48 hours, frequently appearing clumpy or as a surface pellicle. After the turbidity had become equally thicker, the colour of some of the tubes containing the microbial sample was yellow or orange. The total cell count varied from one sampling site to another (Table 1). The enrichment samples were given codes viz. MBT006, MBTO07, MBT008, MBTOOY. MBT010, MBT011, MBT012, MBT013, MBT014 and MBT018. Table 1. Total cell count of live and cultivable cells in samples. Sample Temperature pH CFU/ml MBT006 67 7 6.010 MBT007 52 6.9 5.2x10° MBT008 49 7 4.7x10° MBT009 52 7d 5.1*10° MBT010 51 6.9 Not Determined MBT011 53 7 2.9x103 MBT012 54 6 2.1*103 MBT013 52 6 1.4104 MBT014 51 7 5.7*108 MBT018 49 7 5.2*109 The variation of colonies count was observed at different sampling sites. These ten samples were cultured at 70°C. It was noted that the number of CFUs in sample 1 i.e. MBTO006 is greater (6.0x10%) and decreased as we move away from the main hot water source towards sites 2, 3, 4 and so on. Identification and differentiation of isolates The bacterial strains exhibited different colony and cell morphology. Under light microscope, all were detected as rods either single or were arranged in chains. Within 24 hours of incubation at 70°C, compact spreading colonies were seen which were yellow, white, creamy, brown and greyish white in colour. Morphologically, the strains exhibited some difference in the colour, shape, texture and margin of the colonies (Table 2). They appeared creamy, white and grey; translucent or Opaque; smooth or rough; with regular or irregular edges. The colonies appeared either raised or flat on the agar surface. Diversity of culturable thermophilic bacteria from Tata Pani hotspring ... 7 Table 2. Morphological characteristics. Sample Shape Margin Visual colour Colour under microscope Elevation Texture MBTO006 Regular Smooth White-creamy Dark brown Raised Creamy MBT007 Irregular Smooth Grey-yellow Dark brown Raised Creamy MBT008 Regular Smooth white Golden Flat Creamy MBTO09 Irregular Rough White-creamy Dark brown Raised Sticky MBT010 Irregular Smooth Grey-brown Dark brown Raised Creamy MBT011 Regular Rough White Brown Raised Creamy MBT012 Irregular Smooth Off-white Dark brown Flat Creamy MBT013 Regular Smooth Yellow Pale Raised Sticky MBT014 Regular Rough Pale Brown Raised Creamy MBT018 Irregular Smooth Off-white Golden Raised Creamy Biochemical and Metabolic Characterisation of the bacterial Isolates The biochemical characterisation was done by API 20E strips for identifying phenotypic diversity and none of the ten isolates shared the common phenotypic characters (Table 3). All the isolates were positive for B-galactosidase and citrate utilization. Most of the isolates were unable to metabolise many sugars i.e.nositol, mannitol, sorbitol, rhamnose, melibiose, sucrose and amygdalin. However, a few isolates showed glucose and arabinose utilization (Table 4). Only two isolates i.e. MBT011 and MBT012 exhibited positive results for indole production. All except two (MBT0O06 and MBT012) were able to produce gelatinase enzyme. Table 3. Cell morphology of bacterial isolates. Strains Cell shape Gram staining Arrangement MBTO006 Rod +ve Pairs/clusters MBT007 Rod +ve Pairs MBT008 Rod +ve Pairs MBTO009 Rod +ve Clusters MBT010 Rod +ve Pairs/clusters MBT011 Rod +ve Pairs/clusters MBT012 Rod +ve Pairs/clusters MBT013 Rod +ve Pairs MBT014 Rod +ve Pairs/clusters MBT018 Rod +ve Clusters 8 Ishaq K et al Table 4. Biochemical characteristics of bacterial isolates. Tests MBT006 MBT007 MBT008 MBT009 MBT010 MBT011 MBT012 MBT013 MBT014 MBT018 B- + + + + + + + + + + galactosidase L-arginine + + + + + + L-lysine + *; Citrate + + + + + + + + + + utilisation H2S + + + + + production L- + + + + + + + tryptophane Indole + + production Acetoin + + + + + + + + production Gelatinase + + + + + + + £ D-glucose + + + + + D-manitol Inositol D-sorbitol L-rhamnose~_ + + D-sucrose D-melibiose = + + + + Amygdalin + + + L-arabinose + + + + Cytochrome- + + + + + + + + oxidase Antibiotic sensitivity The antibiotic sensitivity profile of the bacterial isolates showed that all isolates were sensitive to amoxicillin (Ax) and levofloxacin (LEV) and resistant towards metronidazole (MET). The strains MBTO0O9 and MBT012 were found resistant to clarithromycin (CLR) and linezolid (LNZ), while most of the strains showed resistance against AZM (Table 5). Physiological characteristics Physiological studies were performed with all the ten strains. Temperature (a physiological limiting factor) controls the microbial cells multiplication. The temperature of water governs distribution of microbes within hot springs. The association between growth rate and Diversity of culturable thermophilic bacteria from Tata Pani hotspring ... 9 temperature is shown in Fig. 2. The optimum temperature for their growth was 70°C, the maximum growth temperature was 80°C and the minimum temperature was about 40°C. The maximum growth of bacterial isolates was observed when incubated overnight at 70°C. At 40°C and 80°C, no growth was observed; minimum growth was appeared after incubation at 50°C and 60°C. These results depict that the optimal temperature for growth of these isolates was 70°C. Table 5. Antibiotic resistance spectra of thermophilic bacterial strains by the disc diffusion method. Strains Ax MET LEV SXT Cip CFM PRL AZM CLR LNZ MBT006 24 0 32 25 30 16 18 0 41 17 (S) (R) (S) (S) (S) (S) (S) (R) (S) (S) MBT007 29 0 25 16 42 0 34 21 0 20 (S) (R) (S) (S) (S) (R) (S) (S) (R) (S) MBT008 17 0 24 0 16 24 19 0 30 0 (S) (R) (S) (R) (S) (S) (S) (R) (S) (R) MBT009 26 0 24 19 0 17 0 23 0 0 (S) (R) (S) (S) (R) (S) (R) (S) (R) (R) MBT010 16 0 22 24 41 0 18 0 26 16 (S) (R) (S) (S) (S) (R) (S) (R) (S) (S) MBT011 30 0 20 26 30 19 16 0 32 26 (S) (R) (S) (S) (S) (S) (S) (R) (S) (S) MBT012 21 16 24 0 17 30 36 18 0 0 (S) (S) (S) (R) (S) (S) (S) (S) (R) (R) MBT013 24 0 32 20 0 30 18 0 26 32 (S) (R) (S) (S) (S) (S) (S) (R) (S) (S) MBT014 17 0 30 16 28 18 26 0 32 30 (S) (R) (S) (S) (S) (S) (S) (R) (S) (S) MBT018 18 0 18 34 26 18 30 17 16 20 (S) (R) (S) (S) (S) (S) (S) (S) (S) (S) In addition to temperature, pH of water is an important factor defining the microbial diversity in hot water springs. All isolated strains were inoculated in LB broth with different pH ranges from 6.0-9.0. Good growth was noted at pH 7 and it is considered as the optimum pH for the growth of thermophilic bacteria as shown in Fig. 2. The growth rate was also measured at varying time intervals in order to obtain the optimum growth period. Best growth was observed after 48 hours of incubation. From these results, the optimum time for growth of thermophiles was considered at 48 hours. Similarly, the growth rate of thermophilic bacteria was observed best when incubatd with 50 ul of inoculum. 18 a —*— MBT006 1,2 16 fs —™— MBT007 —e MBTOOS 14 ALJN\ msToos —@—MB7007 i, ‘ + 12 ——MBTOOS os é— MBTOOS 1 V4 —+— MBTO10 —— MBTOO9 ‘ o6 MBT010 08 i —®MBTO1L —>— MBT010 ’ i as 06 ; \ MBT012 04 —e MeT022 4 s MB8T013 : MBT012 o4 3 02 ——e MRTO13 = MBTO14 ‘ MBTO13 02 1 0 MBT018 ° MBT014 oc 50¢ 60c 70C 80¢ pHOG pHO7 pHos pHoo MBTO18 —¢— MBTOOS 093 1.2 —MBT006 we - = MBTO07 08 —— é —@—M8T007 ' FA i ier = MBTOOS P= t— MBTO Fy, ‘ ——MBTOOS 6 j ve — ——MsTO0S + —— MBTO1 5 06 vie —+—MBT010 —*MaTo11 —eMBTO1i 04 "87012 3 MBTO12 . ABTOIS 02 MBT013 (BTO14 MB8T014 ° = MBT018 Pt ~~ MBT018 aos of he tame 25, Soul 75, 1001! Figure 2. EE) Measuring growth rate of bacteria. (A) Growth rate of isolates at different temperatures. (B) Growth rate of isolates at different pH; (C) Growth rate of isolates at different incubation periods; (D) Growth rate of isolates at different inoculum size. Molecular characterisation of the Isolates For the ultimate identification and phylogenetic study of the strains, 16S rDNA gene sequencing was done following the Basic Local Alignment Search Tool (BLAST) programme. The 16S rDNA gene sequences of the five isolates were aligned with their associated bacterial sequences from the GenBank databases. Sequence analysis revealed high affiliation with those of the linked strains available in GenBank. The sequence alignment showed that all the strains belonged to genus Anoxybacillus with significant sequence similarity as listed in Table 6. Table 6. List of thermophillic bacteria identified on the basis of 16S rRNA genes. Percentage similarity Isolate code Closest affiliation Accession number MBTO008 Anoxybacillus kamchatkensis OM918284 100 MBT009 Anoxybacillus gonensis OM918285 99.83 MBT012 Anoxybacillus mongoliensis OM918286 99.57 MBT014 Anoxybacillus tengchongensis OM918287 99.43 MBT018 Anoxybacilluss karvacharensis OM918288 98.70 The phylogenetic tree was constructed for all the isolated strains, based upon 16S rDNA gene sequence alignment. BLAST analysis showed the strongest similarity (100%) of the strain MBT008 with A. kamchatkensis and MBT009 (99.83%) with A. gonensis. MBT012 Diversity of culturable thermophilic bacteria from Tata Pani hotspring ... 11 showed 99.57% similarity with A. mongoliensisas, MBT014 with A. tengchongensis (99.43%) and MBT018 was closely related to A. karvacharensis (98.70%) (Fig. 3). | a" WA IBA IA 1:770-1375 Anowybactin fayihermun Van K-09 165 ribosomal INA gene parte! sequence so is008 £:763-470 Anenbattin lamavatianais Sucin TAt3 108 enccemat Riis guna parts semuense | hak 90862. 1:789-$280 Anceybaciin hamchathensis twain J-1B 16% rbosomal RMA gene partial sequence me ; we O'R 104001.1:790 1400 Phnobactenum tevmophaun s¥ain G21 163 reosomal RNA partial sequance ones NODS. 1 NOL 197 Aron bocinn tamermn wine favOermun sPan DSM 2641 165 mboscma RNA pert tequence | 00 "1005006. 1:706-1371 Anonybactin gonensis strain Liw-8 165 ribosomal INA gene partial sequence | 87008 | M0 12066. 1:704-1388 Anomybactius hamchathensis strain TS13 166 ribosomal FINA gene partial sequence t MK418417.1:829.1423 Anomybectiun karvacharensis train K} 165 rbosomal RNA gene partal sequence MK418414,1:781-1375 Aromybacitus favinermen strain K-00 165 ribosomal RNA gene partial sequence D) werors Figure 3. EES Phylogenetic trees of Tatapani hot spring isolates which have the highest homology with the genus Anoxybacillus. The phylogenetic trees were constructed using the neighbour-joining method, based on total 16S rDNA sequencing with 100 bootstrap replicates (software MEGAX). (A) MBT009 showing similarity with A. gonensis; (B) MBT012 showing similarity with A. mongoliensisas; (C) MBT014 with A. tengchongensis; (D) MBT008 with A. kamchatkensis; (E) MBT018 was closely related to A. karvacharensis. The genus Anoxybacillus was abundant in the majority of the explored locations; the presence of Anoxybacillus in the majority of sampled sites is ascribed to the capability of the genus to pass at higher rates, as well as their potential to resist extreme environmental stresses. Discussion Geothermal environments are enriched by the diversity of thermophilic archaea and bacteria. Many thermophilic and hyperthermophilic archaea have been isolated from geothermal and hydrothermal systems. In order to obtain a better understanding of microbial ecosystems and roles in the geothermic community, many studies have been performed to reveal the link between microbial niches, diversity and physicochemical factors, such as temperature, pH and water chemistry (Skirnisdottir et al. 2000, Purcell et al. 2007, Pearson et al. 2008, Everroad et al. 2012, Wang et al. 2013). The hot spring of Tattapani is a habitat for the diversity of thermophilic microorganisms and it represents the functional adaptations of these microbes to withstand extreme temperatures. 12 Ishag K et al One of the studies (Nakagawa and Fukui 2002) reported that the bacterial communities in streamers with a temperature above 65°C was abundant in Thermus, Thermodesulfo bacteria, Crenarchaeota and Aquificae. In 1995, Miquel firstly characterised the aerobic thermophilic, spore forming bacteria, which were able to grow at 70°C (Miquel 1995). Bacteria belonging to the genus Thermus had become important in thermophile research after the isolation of Thermus aquaticus carried out by Brock and Freeze (1969). Later on, numerous additional Thermus species have been discovered. However, in this study, the existence of thermophilic bacteria related to genus Anoxybacillus were investigated in thermal spring of Tatapani, Pakistan. All of the isolated thermophiles belong to the domain bacteria, phylum firmicutes, class bacilli, order bacillales, within family bacillaceae (http:// rdp.cme.msu.edu/ seqmatch). Therefore, it is clear that the water sample enriched with NB media was appropriate for growth of the genus Bacillus. The decrease in CFU with change in altitude is attributed to the gradual decrease in temperature of water when the sample was taken some distance away from the hot spring. The temperature significantly influenced the bacterial richness. Occurence of bacteria, at elevated temperatures, is due to numerous adaptations in physiological conditions and genetics as the stress response to maintain homeostasis (Wang et al. 2015). Microorganisms grow across a wide temperature range, pH, salinity and oxygen levels. Extremophilic microorganisms have the potential to grow in diverse extreme environments, such as low or high temperature, alkaline and acidic pH, high radiations and high salinity (Mirete et al. 2016). The optimal temperature observed for maximum growth of isolates in our study was 70°C, optimal pH observed was 7.0 and optimal time interval was 48 hours. Large-scale comparisons of genomes of mesophiles and thermophiles had confirmed that genomes of the thermophiles contain a higher guanine and cytosine (GC) content than that of mesophiles (Takami et al. 2004, Wang et al. 2015). It has been established that a high GC content is related to the thermal stability of the genome and optimal growth temperature of microbes (Musto et al. 2005, Musto et al. 2006). In addition, rRNAs and tRNAs, that serve as the translational machinery for most of the thermophiles, were reported to contain high GC contents as well (Higgs and Ran 2008, Satapathy et al. 2010). The results of phenotypic and physiological characters of thermophilic bacterial isolates, MBT010 and MBT008 are in line with those reported by Bisht and Panda (2011), whereas the bacterial strain MBT011 is in agreement with outcomes of the studies by Shida et al. (1997) and for the thermophilic bacterial strains MBT006 and MBT018, our findings also correlate with the study of Mohammed in 2012, who isolated the three new species of moderately thermophilic bacteria from three hot springs, located in Jazan District, south- western of Saudi Arabia. They did the phylogenetic analysis of these strains using their 16S rDNA sequence and also studied the morphological, biochemical and physiological characteristics of the isolates (Mohammad A. Khiyami 2012). On the basis of phenotypical and physiological features, these isolated thermophiles also depicted consistent results with those of Rastogi et al. (2009). Diversity of culturable thermophilic bacteria from Tata Pani hotspring ... 13 In another study from Pakistan, Zahra et al in 2020 isolated strain AK9 from the hot water spring of Tattapani Azad Kashmir, Pakistan; extracted and purified cellulase enzyme which reserved its activity from 50-70°C and 3-7 pH. They reported that B. amyloliquefaciens AK9 can be used in bioconversion of lignocellulosic biomass to fermentable sugar (Amin et al. 2016a, Amin et al. 2016b,Zahra et al. 2020). The phylogenetic analysis, based on 16S rRNA gene similarity, depicted that the strain MBTOO9 was affiliated with the species Anoxybacillus gonensis with 99.83% sequence similarity as shown in Fig. 3(A). Our results are consistent with the results of Dai et al. (2011) who had isolated the E13T strain from water-sediment samples from springs in Yunnan Province of China, closely related to the species of A. flavithermus (99.2% sequence similarity). These findings also resemble the study in which Chan et al. (2015) identified bacterial strains affiliated with genra Anoxybacillus and Geobacillus from a Malaysian hot spring. Their results revealed a clear domination of the genus Anoxybacillus represented by A. thermarum, A. flavithermus and A. pushchinoensis (Chan et al. 2015). Our study correlates with the study of Balsam et al. (2017) in which they reported the morphological, microscopic, biochemical, molecular and physiological characterisation of ten isolates isolated from hot springs in Jordan; out of which nine isolates belonged to the genus Bacillus. Anoxybacillus a relatively new genus, is alkali tolerant, Gram-positive rod, tested positive for catalase and oxidase activity. In Pakistan, this genus has been identified and characterised by Jabeen et al. in 2019 from the hot water spring in Chakwal (Jabeen et al. 2019). In our study, one of the isolates namely MBTOO9 had nearest similarity (99.83%) with Anoxybacillus gonensis which was related to the study of Belduz et al. (2003), who had isolated the thermophilic strain G2T (which showed strong homology > 97% with A. gonensis) from mud and water samples from the Gonen and Diyadin hot springs, respectively, located in the Turkish provinces of Balikesir and Agri. They had screened the strains for thermostable enzyme production and found that both strains had the ability to produce industrially-important enzymes (Belduz et al. 2003). Conclusion Thermophiles are unique organisms with tremendous diversity and biological significance. Azad Jammu Kashmir is an unexplored area with blessed sources of hot springs. The microbial diversity of hot springs from Kotli AJK has been explored for the first time on the basis of morphological, biochemical and molecular markers. In this study, ten (10) strains of thermophilic bacteria were isolated from different locations of geothermal hot springs of Tatapani. The 16s gene sequence revealed striking genetic variability in these isolates. These strains were related to genus Anoxybacillus with significant levels of similarity. It was clearly demonstrated that the thermal water of Tatapani (Kotli) hot spring can be an important source of diversity of thermophilic bacteria which is of great significance for 14 Ishag K et al biotechnological processes at elevated temperatures. It is important to report that this is the first study to reveal this hot spring from a single common source for a diversity of numerous thermophillic bacteria, so their applications in the field of biotechnology can be exploited for the production of thermostable enzymes, as well as their metabolites can be used in various biotechnological processes. The study provided an authentic base for studies on complete genomic characterisation and are highly recommended for generating more deatiled information of novel isolates. Acknowledgements The authors acknowledge the financial and logistic support provided by Finance and Transport sections of University of Kotli AU&K. Hosting institution University of Kotli Azad Jammu and Kashmir Author contributions Asad Hussain Shah conceived the idea and led the project. Kazima Ishaq performed the experiments and wrote the manuscript. Anila Farig performed the experiments and wrote the manuscript. Sajida Rasheed analysed the data. Sammyia Jannat interpreted the data and reviewed the manuscript. Conflicts of interest None. References ° Adiguzel A, Ozkan H, Baris O, Inan K, Gulluce M, Sahin F (2009) Identification and characterization of thermophilic bacteria isolated from hot springs in Turkey. Journal of Microbiological Methods 79 (3): 321-328. https://doi.org/10.1016/j.mimet.2009.09.026 ° Amin A, Ahmed |, Habib N, Abbas S, Xiao M, Hozzein W, Li W (2016a) Nocardioides pakistanensis sp. nov., isolated from a hot water spring of Tatta Pani in Pakistan. Antonie van Leeuwenhoek 109 (8): 1101-1109. https://doi.org/10.1007/ $10482-016-0711-8 Diversity of culturable thermophilic bacteria from Tata Pani hotspring ... 15 Amin A, Ahmed I, Khalid N, Osman G, Khan IU, Xiao M, Li W (2016b) Streptomyces caldifontis sp. nov., isolated from a hot water spring of Tatta Pani, Kotli, Pakistan. Antonie van Leeuwenhoek 110 (1): 77-86. https://doi.org/10.1007/s10482-016-07 78-2 Balsam M, Al Daghistani H, Jaouani A, Abdel-Latif S, Kennes C (2017) Isolation and characterization of thermophilic bacteria from Jordanian hot springs: Bacillus licheniformis and Thermomonas hydrothermalis isolates as potential producers of thermostable enzymes. International Journal of Microbiology 2017: 1-12. https://doi.org/ 10.1155/2017/6943952 Belduz AO, Dulger S, Demirbag Z (2003) Anoxybacillus gonensis sp. nov., a moderately thermophilic, xylose-utilizing, endospore-forming bacterium. International Journal of Systematic and Evolutionary Microbiology 53 (Pt 5): 1315-1320. https://doi.org/10.1099/ ijs.0.02473-0 Bisht SS, Panda AK (2011) Biochemical characterization and 16S rRNA sequencing of few lipase-producing thermophilic bacteria from Taptapani hot water spring, Orissa, India. Biotechnology Research International 2011: 452710. https://doi.org/ 10.4061/2011/452710 Brock TD, Freeze H (1969) Thermus aquaticus gen. n. and sp. n., a nonsporulating extreme thermophile. Journal of Bacteriology 98 (1): 289-97. https://doi.org/10.1128/jb. 98.1.289-297.1969 Chan CS, Chan K, Tay Y, Chua Y, Goh KM (2015) Diversity of thermophiles in a Malaysian hot spring determined using 16S rRNA and shotgun metagenome sequencing. Frontiers in Microbiology 6 hittps://doi.org/10.3389/fmicb.2015.00177 Cheng H, Jiang N (2006) Extremely rapid extraction of DNA from bacteria and yeasts. Biotechnology Letters 28 (1): 55-9. https://doi.org/10.1007/s10529-005-4688-z Dai J, Liu Y, Lei Y, Gao Y, Han F, Xiao Y, Peng H (2011) Anew subspecies of Anoxybacillus flavithermus ssp. yunnanensis ssp. nov. with very high ethanol tolerance. FEMS Microbiology Letters 320 (1): 72-78. httos://doi.org/10.1111/j. 1574-6968.2011.02294.x Derekova A, Mandeva R, Kambourova M (2008) Phylogenetic diversity of thermophilic carbohydrate degrading bacilli from Bulgarian hot springs. World Journal of Microbiology and Biotechnology 24 (9): 1697-1702. https://doi.org/10.1007/ $11274-008-9663-0 Everroad RC, Otaki H, Matsuura K, Haruta S (2012) Diversification of bacterial community composition along a temperature gradient at a thermal spring. Microbes and Environments 27 (4): 374-381. https://doi.org/10.1264/jsme2.me11350 Gul-Guven R, Guven K, Poli A, Nicolaus B (2008) Anoxybacillus kamchatkensis subsp. asaccharedens subsp. nov., a thermophilic bacterium isolated from a hot spring in Batman. The Journal of General and Applied Microbiology 54 (6): 327-34. httops:// doi.org/10.2323/jgam.54.327 Higgs PG, Ran W (2008) Coevolution of codon usage and tRNA genes leads to alternative stable states of biased codon usage. Molecular Biology and Evolution 25 (11): 2279-91. https://doi.org/10.1093/molbev/msn173 Jabeen F, Muneer B, Qazi JI (2019) Characterization of thermophilic bacteria Anoxybacillus rupiensis and cultivation in agroindustrial wastes isolated from hot spring in Chakwal, Pakistan. Pakistan Journal of Zoology 51 (4). https://doi.org/10.17582/ journal.pjz/2019.51.4.1243.1250 16 Ishag K et al Kozina K, Kolganova TV, Chernyh NA, Bonch-Osmolovskaya EA (2010) Caldanaero bacteruzonensis sp. nov., ananaerobic, thermophilic, heterotrophic bacterium isolated from a hot spring. International Journal of Systematic and Evolutionary Microbiology 60: 1372-5. https://doi.org/10.1099/ijs.0.012328-0 Kumar, et al. (2010) Characterization of hot water spring source isolated clones of bacteria and their industrial applicability. International Journal of Chemical Research 2: 01-07. https://doi.org/10.9735/0975-3699.2.1.1-7 Lau MY, Aitchison J, Pointing S (2008) Bacterial community composition in thermophilic microbial mats from five hot springs in Central Tibet. Extremophiles 13 (1): 139-149. https://doi.org/10.1007/s00792-008-0205-3 Maugeri T, Gugliandolo C, Caccamo D, Stackebrandt E (2001) A polyphasic taxonomic study of thermophilic bacilli from shallow, Marine Vents. Systematic and Applied Microbiology 24 (4): 572-587. https://doi.org/10.1078/0723-2020-00054 Miquel A (1995) De I’« Ecole » au « Collége ». L'apprentissage du savoir vivant209-214. https://doi.org/10.391 7/puf.viall.1995.01.0209 Miquel P (1888) Monographie d'un bacille vivant au-dela de 70 °C. Ann Micrographic 1 (3). Mirete S, Morgante V, Gonzalez-Pastor JE (2016) Functional metagenomics of extreme environments. Current Opinion in Biotechnology 38: 143-9. https://doi.org/10.1016/ j.copbio.2016.01.017 Mohammad A. Khiyami (2012) Thermo-aerobic bacteria from geothermal springs in Saudi Arabia. African Journal of Biotechnology 11 (17). httos://doi.org/10.5897/ ajb11.3339 Musto H, Naya H, Zavala A, Romero H, Alvarez-Valin F, Bernardi G (2005) The correlation between genomic G + C and optimal growth temperature of prokaryotes is robust: A reply to Marashi and Ghalanbor. Biochemical and Biophysical Research Communications 330 (2): 357-360. https://doi.org/10.1016/j.bbrc.2005.02.133 Musto H, Naya H, Zavala A, Romero H, Alvarez-Valin F, Bernardi G (2006) Genomic GC level, optimal growth temperature, and genome size in prokaryotes. Biochemical and Biophysical Research Communications 347 (1): 1-3. https://doi.org/10.1016/j.bbre. 2006.06.054 Nakagawa T, Fukui M (2002) Phylogenetic characterization of microbial mats and streamers from a Japanese alkaline hot spring with a thermal gradient. The Journal of General and Applied Microbiology 48 (4): 211-22. https://doi.org/10.2323/jgam.48.211 Panda AK, Bisht SS, De Mandal S, Kumar NS (2016) Bacterial and archeal community composition in hot springs from Indo-Burma region, North-east India. AMB Express 6 (1): 111. https://doi.org/10.1186/s13568-016-0284-y Pearson A, Pi Y, Zhao W, Li W, Li Y, Inskeep W, Perevalova A, Romanek C, Li S, Zhang C (2008) Factors controlling the distribution of archaeal tetraethers in terrestrial hot springs. Applied and Environmental Microbiology 74 (11): 3523-3532. htips://doi.org/ 10.1128/aem.02450-07 Poli A, Romano I, Cordella P, Orlando P, Nicolaus B, Ceschi Berrini C (2009) Anoxybacillus thermarum sp. nov., a novel thermophilic bacterium isolated from thermal mud in Euganean hot springs, Abano Terme, Italy. Extremophiles 13 (6): 867-874. https://doi.org/10.1007/s00792-009-0274-y Prescott, John P, Harley, Donald A. Klein, Delihas (1997) Microbiology. The Quarterly Review of Biology 72 (4): 472-473. https://doi.org/10.1086/419992 Diversity of culturable thermophilic bacteria from Tata Pani hotspring ... 17 Purcell D, Sompong U, Yim LC, Barraclough T, Peerapornpisal Y, Pointing S (2007) The effects of temperature, pH and sulphide on the community structure of hyperthermophilic streamers in hot springs of Northern Thailand. FEMS Microbiology Ecology 60 (3): 456-466. https://doi.org/10.1111/j.1574-6941.2007.00302.x Rastogi G, Muppidi G, Gurram R, Adhikari A, Bischoff K, Hughes S, Apel W, Bang S, Dixon D, Sani R (2009) Isolation and characterization of cellulose-degrading bacteria from the deep subsurface of the homestake gold mine, Lead, South Dakota, USA. Journal of Industrial Microbiology & Biotechnology 36 (4): 585-598. https://doi.org/ 10.1007/s10295-009-0528-9 Saha P, Mondal AK, Mayilraj S, Krishnamurthi S, Bhattacharya A, Chakrabarti T (2005) Paenibacillus assamensis sp. nov., a novel bacterium isolated from a warm spring in Assam, India. International Journal of Systematic and Evolutionary Microbiology 55 (Pt 6): 2577-2581. https://doi.org/10.1099/ijs.0.63846-0 Satapathy SS, Dutta M, Ray SK (2010) Higher tRNA diversity in thermophilic bacteria: a possible adaptation to growth at high temperature. Microbiological Research 165 (8): 609-16. https://doi.org/10.1016/j.micres.2009.12.003 Sharma A, Pandey A, Shouche YS, Kumar B, Kulkarni G (2008) Characterization and identification of Geobacillus spp. isolated from Soldhar hot spring site of Garhwal Himalaya, India. Journal of Basic Microbiology 49 (2): 187-194. https://doi.org/10.1002/ jobm.200800194 Shida O, Takagi H, Kadowaki K, Nakamura LK, Komagata K (1997) Transfer of Bacillus alginolyticus, Bacillus chondroitinus, Bacillus curdlanolyticus, Bacillus glucanolyticus, Bacillus kobensis, and Bacillus thiaminolyticus to the genus Paenibacillus and emended description of the Genus Paenibacillus. International Journal of Systematic Bacteriology 47 (2): 289-98. https://doi.org/10.1099/00207713-47-2-289 Sievert S, Ziebis W, Kuever J, Sahm K (2000) Relative abundance of archaea and bacteria along a thermal gradient of a shallow-water hydrothermal vent quantified by rRNA slot-blot hybridization. Microbiology 146 (6): 1287-1293. https://doi.org/ 10.1099/00221287-146-6-1287 Singh G, Bhalla A, Kaur P, Capalash N, Sharma P (2011) Laccase from prokaryotes: A new source for an old enzyme. Reviews in Environmental Science and Biotechnology 10 (4): 309-326. https://doi.org/10.1007/s11157-011-9257-4 Skirnisdottir S, Hreggvidsson GO, Hjorleifsdottir S, Marteinsson VT, Petursdottir SK, Holst O, Kristjansson JK (2000) Influence of sulfide and temperature on species composition and community structure of hot spring microbial mats. Applied and Environmental Microbiology 66 (7): 2835-41. https://doi.org/10.1128/AEM. 66.7.2835-2841.2000 Takacs CD, Ehringer M, Favre R, Cermola M, Eggertsson G, Palsdottir A, Reysenbach A (2001) Phylogenetic characterization of the blue filamentous bacterial community from an Icelandic geothermal spring. FEMS Microbiology Ecology 35 (2): 123-128. https:// doi.org/10.1111/).1574-6941.2001.tb00795.x Takami H, Takaki Y, Chee G, Nishi S, Shimamura S, Suzuki H, Matsui S, Uchiyama | (2004) Thermoadaptation trait revealed by the genome sequence of thermophilic Geobacillus kaustophilus. Nucleic Acids Research 32 (21): 6292-303. https://doi.org/ 10.1093/nar/gkh970 18 Ishag K et al Tango MSA, Islam MR (2010) Potential of extremophiles for biotechnological and petroleum applications. Energy Sources 24 (6): 543-559. https://doi.org/ 10.1080/00908310290086554 Wang Q, Cen Z, Zhao J (2015) The survival mechanisms of thermophiles at high temperatures: an angle of omics. Physiology (Bethesda, Md.) 30 (2): 97-106. https:// doi.org/10.1152/physiol.00066.2013 Wang S, Hou W, Dong H, Jiang H, Huang L, Wu G, Zhang C, Song Z, Zhang Y, Ren H, Zhang J, Zhang L (2013) Control of temperature on microbial community structure in hot springs of the Tibetan Plateau. PLOS One 8 (5): e€62901. htips://doi.org/10.1371/ journal.pone.0062901 Waterhouse AM, Procter JB, Martin DMA, Clamp M, Barton GJ (2009) Jalview Version 2 A multiple sequence alignment editor and analysis workbench. Bioinformatics (Oxford, England) 25 (9): 1189-91. https://doi.org/10.1093/bioinformatics/btp033 Yohandini H, Julinar, Muharni (2015) Isolation and phylogenetic analysis of thermophile community within Tanjung Sakti hotspring, South Sumatera, Indonesia. Hayati Journal of Biosciences 22 (3): 143-148. https://doi.org/10.1016/j.hjb.2015.10.006 Zahra T, Irfan M, Nadeem M, Ghazanfar M, Ahmad Q, Ali S, Siddique F, Yasmeen Z, Franco M (2020) Cellulase production by Trichoderma viride in submerged fermentation using response surface methodology. Punjab University Journal of Zoology 35 (2). https://doi.org/10.17582/journal.pujz/2020.35.2.223.228 Zhang H, Kallimanis A, Koukkou Al, Drainas C (2004) Isolation and characterization of novel bacteria degrading polycyclic aromatic hydrocarbons from polluted Greek soils. Applied Microbiology and Biotechnology 65 (1): 124-131.