Biodiversity Data Journal 11: e101579 OO) doi: 10.3897/BDJ.11.e101579 open access Taxonomy & Inventories A new semi-slug of the genus Microparmarion from Brunei, discovered, described and DNA- barcoded on citizen-science ‘taxon expeditions’ (Gastropoda, Stylommatophora, Ariophantidae) Menno Schilthuizen*5:'1, Simon Berenyi*1, Nurilya Syamimi Muhammad Nazirul Ezzwan"4, Nur Izzah Amal Afiqah Hamdani"™+¥, Harrison Wu" +t, Luca De Antoni“, Leonardo Vincenzi*+, Werner de Gier$:+-”, Anthonie D. P. van Peursen* 1, Iva Njunji¢*S:1, Massimo Delledonne“?, Ferry Slik +, Ulmar Grafe'?, Daniele Cicuzza™+ + Taxon Expeditions B. V., Leiden, Netherlands § Naturalis Biodiversity Center, Leiden, Netherlands | Institute Biology Leiden, Leiden University, Leiden, Netherlands ¥ Universiti Brunei Darussalam, Bandar Seri Begawan, Brunei # Taxon Expeditions, Leiden, Netherlands = University of British Columbia, Kelowna, Canada « Department of Biotechnology, University of Verona, Verona, Italy » Groningen Institute for Evolutionary Life Sciences, University of Groningen, Groningen, Netherlands “ Environmental and Life Sciences, Faculty of Science, Universiti Brunei Darussalam, Bandar Seri Begawan, Brunei Corresponding author: Iva Njunji¢ (info@taxonexpeditions.com) Academic editor: Ivailo Dedov Received: 06 Feb 2023 | Accepted: 23 Mar 2023 | Published: 10 Apr 2023 Citation: Schilthuizen M, Berenyi S, Ezzwan NSMN, Hamdani NIAA, Wu H, De Antoni L, Vincenzi L, de Gier W, van Peursen ADP, Njunjié |, Delledonne M, Slik F, Grafe U, Cicuzza D (2023) A new semi-slug of the genus Microparmarion from Brunei, discovered, described and DNA-barcoded on citizen-science 'taxon expeditions' (Gastropoda, Stylommatophora, Ariophantidae). Biodiversity Data Journal 11: e101579. httos://doi.org/10.3897/BDJ.11.e101579 ZooBank: urn:|sid:zoobank.org:pub:255EDB9A-1BD3-425F-9FEC-9FB369FD6065 © Schilthuizen M et al. This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. 2 Schilthuizen M et al Abstract Background During citizen-science expeditions to the Ulu Temburong National Park, Brunei, several individuals were collected of a semi-slug species of the genus Microparmarion that, based on morphology and in-the-field DNA-barcoding, was found to be an undescribed species. New information In this paper, we describe Microparmarion sallehi Wu, Ezzwan & Hamdani, n. sp., after field centre supervisor Md Salleh Abdullah Bat. We provide details on the external and internal reproductive morphology, the shell and the ecology of the type locality, as well as a diagnosis comparing it with related species. DNA barcodes were generated for five individuals and used for a phylogenetic reconstruction. Microparmarion sallehi sp. n. and M. exquadratus Schilthuizen et al., 2019 so far are the only Bornean species of the genus that live in lowland forest; other species are found in montane forests. Keywords taxonomy, malacology, Borneo, new species, land snails, semi-slugs Introduction Surveys of terrestrial gastropod faunas in Southeast Asia largely rely on the collection of empty shells, especially in non-calcareous regions, where densities of live snails can be very low, compared to empty shells that can be extracted from soil samples by visual search and by flotation (Schilthuizen 2011). Due to this tradition, slugs and semi-slugs have been undersampled, as they either have no shell (e.g. Philomycidae, Rathouisiidae, Veronicellidae) or a shell that will not float during flotation (Ariophantidae). Consequently, our knowledge of Southeast Asian slugs and semi-slugs almost entirely depends on live collections, usually at night, as the animals are predominantly nocturnal. Further complications to the study of these groups lie in the rarity of most species and the fact that dissection is usually required to obtain diagnostic characters. Consequently, the number of specimens in collections is low and many new species probably remain to be discovered. During three citizen-science expeditions/field courses in the lowland forests of Ulu Temburong National Park, Brunei Darussalam, in the northwest of the island of Borneo, we found several individuals of a Microparmarion species. Although the species externally resembled other Bornean lowland congenerics, DNA-barcoding performed in the field lab showed that the Brunei specimens belong to a distantly-related species. Further morphological examination in the field lab confirmed this. Consequently, the material was described as a new Species in a field course project. A new semi-slug of the genus Microparmarion from Brunei, discovered, described ... 3 Materials and methods Fieldwork Three expeditions/field courses were held in the Kuala Belalong Field Studies Centre (KBFSC), located at 4.54°N, 115.16°E, at 100 m elevation, which is managed by the Institute of Biodiversity and Environmental Research (IBER) and Universiti Brunei Darussalam (UBD) (Murrell et al. 2018). These field trips took place during the following periods: 25.09.-8.10.2018, 25.09.-4.10.2019 and 11-20.10.2022. The field centre is located in a primary lowland dipterocarp forest reserve with a surface area of ca. 50,000 ha (Goyes Vallejos et al. 2017), but it also includes some riverine sites with secondary forest. On each trip, teams consisting of local and international scientists, students and laypersons worked together on a combined programme of biodiversity training and exploration. During night surveys, semi-slugs were occasionally found. Specimens When semi-slugs were encountered in the field, they were placed alive in plastic vials and, in the field lab, were drowned in water for a maximum of 24 hours. Each specimen received a field code. Then, in most cases, a tissue sample was removed (usually from the tail) and placed into 100% ethanol, while the rest of the body was preserved in 70% ethanol. Overall, five individuals were found and studied. Full details of the specimens are given in the Types section of the taxon treatment below. After study, specimens were deposited in the Universiti Brunei Darusaalam Museum (UBDM), Naturalis Biodiversity Center (RMNH) and the Taxon Expeditions collection (TXEX). Morphology Photographs of several of the living individuals were taken in the lab. Imaging of the preserved individuals and their shells was done with a smartphone through the eyepiece of a Nikon C-PSN dissection microscope. Pencil drawings of shells were made by tracing photos on a laptop computer screen. Descriptions of the external morphology were made by careful examination of specimens maintained in 70% ethanol. Dissections were carried out in 70% ethanol, using two pairs of sharp dissection forceps and imaged by fixing the dissected parts on a black wax surface with insect pins, submerging them in 70% ethanol, then fixing the tissue with 100% ethanol, removing the pins and photographing with a smartphone through the eyepiece of the dissection microscope. Even though the internal structure of the male genitalia may contain relevant diagnostic features, we refrained from opening the penis and epiphallus in the only adult specimen we had, so as not to prevent interpretation of the external form in future studies. Molecular work The extraction of DNA was done by cutting small pieces of semi-slug tissue and performing the DNeasy Blood & Tissue kit (Qiagen) protocol, which yielded the template to be used 4 Schilthuizen M et al during PCR, to amplify the cytochrome c oxidase subunit | (CO/) barcoding region using the primers LCO1490 and HC02198 of Folmer et al. (1994), tailed at 5’ with Oxford Nanopore adapters. The quality control of the DNA quantification of the DNA concentration was done by performing a Qubit fluorometer test and testing its integrity using agarose gel. Successful bands allowed the purification of the samples, to avoid contaminants, using AMPure XP Beads. Every amplicon was marked with a specific barcode using the PCR- barcoding kit (Oxford Nanopore Technologies). DNA libraries were prepared from pools of amplicons with the Ligation Sequencing Kit 1D (Oxford Nanopore Technologies). Samples were then sequenced using the MinlION device (Oxford Nanopore Technologies) in an R9.4 flowcell that can operate up to 36 GB/run (Menegon et al. 2017,Maestri et al. 2019). After sequencing, the data from the MinlON device were base-called using a pipeline performed by the ONT Preprocessing Pipeline software that base-calls sequences. These reads were further examined with the OnTrack2, enabling rapid and accurate taxonomic assignment. The sequences (as well as data and images of the corresponding specimens, with sample IDs as displayed in the list of material below) were deposited on the Barcoding of Life Database (BOLD; www.boldsystems.org) under numbers TXEX074-23, TXEX075-23, TXEX076-23, TXEX077-23 and TXEX078-23. Phylogenetic analysis To confirm conspecificity of all specimens and monophyly of the new species and also to ascertain its status with respect to related species, we downloaded all available DNA barcodes for Microparmarion from BOLD and GenBank. These, together with the newly- generated sequences and four sequences of Parmarion martensi Simroth, 1893, to be used as outgroup, were aligned in Geneious Prime v.2023.0.1 using the MUSCLE 5.1 (Edgar 2004) option, the PPP algorithm and otherwise default settings. The aligned 31 sequences were then phylogenetically analysed using the PhyML plug-in of Geneious Prime (Guindon et al. 2010). The evolutionary model was general time-reversible, fixed proportion of invariable sites, four substitution rate categories, estimated gamma distribution and 100 bootstrap replicates. Trees were managed in FigTree v.1.4.2 and the P. martensi outgroup sequences (GenBank accession number FJ481180 and BOLD record numbers KCAS058-14—KCAS060-14) were used for rooting the trees. Taxon treatment Microparmarion sallehi Wu, Ezzwan & Hamdani, sp. n. * ZooBank 08137C97-B73B-4E05-A915-5B56AE5048C9 Materials Holotype: a. scientificName: Microparmarion sallehi; country: Brunei; stateProvince: Temburong District; locality: Kuala Belalong Field Studies Centre, Ashton trail; verbatimElevation: 100 m; decimalLatitude: 4.547; decimalLongitude: 115.157; georeferenceProtocol: GPS; eventDate: 26/09/2018; individualCount: 1; lifeStage: adult; catalogNumber: UBDM. A new semi-slug of the genus Microparmarion from Brunei, discovered, described ... 5 7.00152; recordedBy: Simon Berenyi; identifiedBy: Menno Schilthuizen; dateldentified: 2022; language: en; basisOfRecord: PreservedSpecimen; occurrencelD: E8F80EB3-496A-55DB-AB38-9B8F961214A7 Paratypes: a. scientificName: Microparmarion sallehi, country: Brunei; stateProvince: Temburong District; locality: Ulu-Ulu Resort Helipad; verbatimElevation: 100 m; decimalLatitude: 4.555; decimalLongitude: 115.153; georeferenceProtocol: GPS; eventDate: 14/10/2022; individualCount: 1; lifeStage: juvenile; catalogNumber: RMNH.MOL.328207; recordedBy: Menno Schilthuizen; identifiedBy: Menno Schilthuizen; date!dentified: 2022; language: en; basisOfRecord: PreservedSpecimen; occurrence!D: DABF18BA-CA1A-5E23-8436- C2902ACB3909 b. scientificName: Microparmarion sallehi,; country: Brunei; stateProvince: Temburong District; locality: Kuala Belalong Field Studies Centre, Ashton trail; verbatimElevation: 100 m; decimalLatitude: 4.547; decimalLongitude: 115.157; georeferenceProtocol: GPS; eventDate: 16/10/2022; individualCount: 1; lifeStage: juvenile; catalogNumber: TxEx- BR2202; recordedBy: Iva Njunjic; identifiedBy: Menno Schilthuizen; date!dentified: 2022; language: en; basisOfRecord: PreservedSpecimen; occurrencelD: E66016F3-86E1-5F46-AC2C-6C3D1535162D C. scientificName: Microparmarion sallehi; country: Brunei; stateProvince: Temburong District; locality: Kuala Belalong Field Studies Centre, Ashton trail; verbatimElevation: 100 m; decimalLatitude: 4.547; decimalLongitude: 115.157; georeferenceProtocol: GPS; eventDate: 16/10/2022; individualCount: 1; lifeStage: juvenile; catalogNumber: TxEx- BR2203; recordedBy: Iva Njunjic; identifiedBy: Menno Schilthuizen; date!dentified: 2022; language: en; basisOfRecord: PreservedSpecimen; occurrence!D: 82288ED8- A035-581D-B1CC-3EC3838F2953 Other material: a. scientificName: Microparmarion sallehi, country: Brunei; stateProvince: Temburong District; locality: Kuala Belalong Field Studies Centre, Ashton trail; verbatimElevation: 100 m; decimalLatitude: 4.547; decimalLongitude: 115.157; georeferenceProtocol: GPS; eventDate: 30/09/2019; individualCount: 1; lifeStage: juvenile; catalogNumber: TxEx- BR1901; recordedBy: Taxon Expeditions; identifiedBy: Menno Schilthuizen; dateldentified: 2022; language: en; basisOfRecord: PreservedSpecimen; occurrencelD: 4B28FD4F-841C-5A38-A713-632CO0FB1C1B Description Preserved specimens (Figs 1, 2). Ethanol-preserved juveniles are 6—11 mm in length. On the dorsal and lateral sides excluding the foot and its margins, there is a blackish- brown mottled pattern on a pale white background. The foot is pale white with a smooth surface, with the lateral head margins of the foot having a blackish-brown mottled pattern; the rest of the margins remain pale white. Three distinct longitudinal dark brown bands run on the head, one starting posterior of each eye tentacle and the third dorsomedially in between these two, starting level with them. These three bands end at the level of the pneumostome. In between the rim of the shell and when the left and right mantle lobes are pulled back, there can be either blackish-brown mottled patterns or stripes that encircle the shell. An unpigmented peripheral ridge runs from the left frontal margin of the mantle, immediately behind the left eye tentacle, circles the shell, Schilthuizen M et al where, on the caudolateral side of the shell, it throws off a short side branch that leads dorsad to the mantle edge; the main branch of the keel continues and ends on the right at the pneumostome. The genital opening is visible on the right lateral side behind the head and appears as a circular pore. In the adult, 29 mm long, the colour patterns are similar to those in the juveniles, but the contrasts are much reduced and colours range from pale light brown to reddish-brown. 10mm Figure 1. EES] Microparmarion sallehi, n. sp., photographs of preserved holotype specimen (UBDM.7.00152), Kuala Belalong Field Studies Centre, Brunei Darussalam; a dorsal view; b left lateral view; c right lateral view. A new semi-slug of the genus Microparmarion from Brunei, discovered, described ... 7 5mm Figure 2. EESl Microparmarion sallehi, n. sp., photographs of preserved paratype specimen (TxEx-BR2203), Kuala Belalong Field Studies Centre, Brunei Darussalam; a dorsal view; b left lateral view; c right lateral view. Living specimens (Fig. 3). Living specimens differ from preserved ones in size (in ethanol, the animals contract to 50% of their live extended length) and in colouration, Schilthuizen M et al as follows. The general colouration for the dorsal side and ventral side is blackish- brown and pale white, respectively. In juveniles, the foot is pale white with a smooth surface, with the lateral frontal margins of the foot having a blackish-brown mottled pattern and the rest of the margins remaining pale white. In adults, this blackish-brown mottled pattern can not only extend to the frontal margins of the foot, but also the caudal margins. The mantle carries a blackish-brown mottled pattern on a pale background, with a yellowish-white streak extending from the left mantle lobe to the mantle itself. In adults, the pattern on the mantle largely disappears and is replaced by an ochre colouration, with the streak being reduced or becoming non-existent. The left and right mantle lobes in both adults and juveniles meet along a curved slit. Anterior to the mantle in juveniles, two longitudinal black stripes on the head that start caudally at the base of the eye tentacles extend towards the anterior part of the mantle. In addition, a dorso-medial black line on the head in between the eye tentacles also extends caudally towards the mantle. In juveniles, all four tentacles may be reddish- or greyish-brown (though the oral tentacles can be pale as well), but in the adult, this is reduced to an ochre brown, with the oral tentacles becoming paler. The caudal horn, dorsal to the caudal end of the foot, is pointed caudally and slightly extends beyond the length of the foot. In the adult, the caudal horn can be pointed or curved downwards. In juveniles, the colouration of the tail is a greyish-brown, with a dark brown mottled pattern. In the adult, this high-contrast colouration is replaced with a general browner colouration, though some mottling remains. Shell: Juvenile shells (Fig. 4a) are oval, 3.5-6.0 mm long and 2.0-4.0 mm wide, of a transparent yellowish-green colouration, slanting towards the left lateral side, which causes a bulge on the left side. The surface is smooth and developmental rings are visible. In lateral view, the shell rim is flattened while the shell smoothly curves into a round bump on top. Whorls are not discernible: the shell consists of a single, oval dish. The adult shell (Fig. 4b) is 11 mm long and 8 mm wide, fingernail-like and similarly displays several darker-coloured growth bands, but no traces of whorls. Genitalia: The penis, at around 5 mm from the connection with the vagina, bends back upon itself in a 2-mm-long loop (Fig. 5). The looped part is of the same width as the proximal part of the penis. Distally, the looped part narrows abruptly and is enveloped by a muscular extension of the penis; the epiphallus, 2.2 mm long, is visible as an initially relatively thick, but then narrowing, sinuous tube inside this muscular sheath. The penis retractor muscle appears to connect at the basis of the epiphallus. Terminally, the epiphallus gives way to the vas deferens. At 4 mm from the genital opening, the gametolytic sac emerges from the vagina. The dart sac is ca. 5 mm long and connects to the vagina at the opposite side from the penis. It is connected to the 10-mm-long, 2-mm-wide dart sac gland by a narrow looped stalk. DNA barcode: The CO/ DNA barcode of the holotype (UBDM.7.00152; BOLD TXEX074-23) is as follows: S’AACAT TATATATAAT TTT TGGAGTTTGATGTGGTATAGTAGGAACAGGCTTATCATTAT TAAT TCGAT TAGAATTAGGTACAGCTGGTGTATTACTTGATGATCATTTTTTTAATGTAA A new semi-slug of the genus Microparmarion from Brunei, discovered, described ... 9 TTGTGACTGCACATGCATTTGTAATAATTTTTTTTATAGTTATACCTATTATAATT GGAG GATTTGGAAATTGAATAGTTCCTT TAT TAATT GGAGCT CCAGATATAAGTTTTCCACGA ATAAATAATATAAGATTTTGATTATTACCTCCTTCATTTGTATTTTTAATTGTTTCTAGTAT GGTTGAAGGTGGTGCAGGAACTGGTTGAACAGTT TATCCACCTT TAAGAGGACCAG TAGGACATGCAGGAGCCTCAGTAGATTTGGCTATTTTTTCTTTACATTTAGCAGGTATA TCATCTATTTTAGGTGCTATTAATTTTATTACTACTATTTTTAACATACGGTCTTCTGGTA TAACTATAGAACGTGTAAGACTATTTGTTTGATCTATTTTAGTAACTGTATTTTTATTACTA TTATCTTTACCTGTACTTGCTGGGGCTATTACAATACTTTTAACTGATCGAAATTTTAATA CTAGTTTTTTTGATCCTGCTGGAGGAGGAGATCCGATTTTATATCAACATTTATTT3° 15mm b 5mm C Figure 3. EE Microparmarion sallehi, n. sp., photographs of living individuals, Kuala Belalong Field Studies Centre, Brunei Darussalam; a holotype, UBDM.7.00152, right lateral view; b holotype, UBDM. 7.00152, left lateral view; c paratype, TxEx-BR2201, right dorsolateral view. Diagnosis This new species of Microparmarion stands out because of its shell, which, unlike other north Bornean species of the genus, has no discernible whorls. In that sense, it 10 Schilthuizen M et al appears to be more closely related to Parmarion, with which it also shares the clearly keeled mantle. However, the genital set-up, with the looped part of the penis, the vas deferens connected terminally to the epiphallus and the unstalked gametolytic sac Clearly fits with the Microparmarion genus definition (Simroth 1893; Vermeulen and Liew 2022). The looped part of the penis, which remains thick until the place where it is enveloped by the muscular sheath, places the species in ‘group 2’ of Vermeulen and Liew (2022). Figure 4. EES] Microparmarion sallehi, n. sp., dorsal views of shells; a pencil drawing of the shell of a paratype specimen (TxEx-BR2201), Helipad, Ulu-Ulu Resort, Brunei Darussalam; b photograph of the shell of the holotype specimen (UBDM.7.00152), Kuala Belalong Field Studies Centre, Brunei Darussalam. Externally similar north Bornean species are M. simrothi Collinge & Godwin-Austen, 1895, M. exquadratus Schilthuizen et al., 2019, and M. convolutus Vermeulen & Liew, 2022. What sets M. sallehi apart from M. simrothi is that the new species lacks WM. simroth’s papillose mantle surface and has partial mottled patterns on the foot margins, whereas in M. simrothi the foot margin has an uninterrupted mottled pattern. The mantle of the new species lacks the uneven, interrupted dark ring close to the periphery of the part of the mantle that covers the shell. In adult M. convolutus, the mantle is smooth, while in the new species, it is covered in low nodules and ripples. The colouration in M. convolutus is whitish, pale orange or pale pink with a slight greyish mottling on the sides and the tail, while the new species is a pale orange as an adult or pale white as a juvenile with a blackish-brown mottled pattern. /. exquadratus, finally, is generally darker in colour: dull orange to pale red with dark brown patterning, while the new species is a pale orange as an adult or pale white as a juvenile with a A new semi-slug of the genus Microparmarion from Brunei, discovered, described ... 11 blackish-brown mottled pattern. M. sallehi has either uninterrupted blackish-brown mottled patterns or horizontal stripes that encircle the shell in juveniles. In adults, these patterns or stripes do not appear. VV. exquadratus, on the other hand, has a mantle with an uneven, wide, locally interrupted dark ring surrounding the lumen otherwise coarsely spotted. In live M. exquadratus, the surface of the mantle is covered in small, irregular pustules, whereas in M. sallehi, there are parallel ripples. In the anatomy, M. sallehin. sp. differs from all these three similar species by the long, strongly developed looped part of the penis, which is as thick and as long as the proximal part of the penis. In M. simrothi, M. exquadratus and M. convolutus, the looped part is always much thinner or differently shaped. looped part of the penis penis retractor oviduct = t epiphallus gametolytic sac ; dart sac gland vagina .. vas deferens dart sac atrium genital opening a Figure 5. Et Microparmarion sallehi, n. sp., preserved holotype specimen (UBDM.7.00152), Kuala Belalong Field Studies Centre, Brunei Darussalam; a dissected genitalia; b detail of penis and epiphallus. Etymology The species epithet is a masculine genitive and honours the supervisor of the Kuala Belalong Field Studies Centre, Mr. Md Salleh Abdullah Bat, who recently retired. The taxon expedition, during which the species was described, was the last group he hosted before retirement. The name won the winning number of votes out of seven options during a voting session in which all participants of the 2022 expedition took part. Ecology This species is generally crepuscular and nocturnal. It was seen at night and in the morning after rain, crawling underneath leaves of saplings and on vines, in both primary and secondary forest. 12 Schilthuizen M et al Parmarion martensi Taiwan (FJ481180) Parmarion cf. martensi Taipei (RMNH.MOL.320732) Parmarion cf. martensi Taipei (RMNH.MOL.320731) Parmarion cf. martensi Taipei (RMNN.MOL.320733) . in. sp. Ulu Temburong (TxEx-BR1901) Temburong (TxEx-BR1801) holotype Jiu Temburong (TxEx-BR2201) paratype Jiu Temburong (TxEx-BR2202) paratype Jiu Temburong (TxEx-BR2203) paratype Microparmarion sp. Kinabalu Park HQ (SP13443) Microparmarion sp Sayap (SP 13449) Microparmarion cf. convolutus Kinabalu Park HQ (SP13444) Microparmarion cf. convolutus Mahua (SP13427) Microparmarion cf. convolutus Gn. Alab (SP13433) Microparmarion exquadratus Tawau Hills Park (SP13552) Microparmarion exquadratus Tawau Hills Park (SP13554) Microparmarion exquadratus Tawau Hills Park (SP13553) Microparmarion cf. pollonerai Gn. Alab (SP13430) Microparmarion simrothi Sayap (SP13441) Microparmarion simrothi Sayap (SP13442) Microparmarion simrothi Layang-Layang (SP13447) Microparmarion simrothi Layang-Layang (SP13446) Microparmarion simrothi Layang-Layang (SP13445) Microparmarion simrothi Layang-Layang (SP13448) Microparmarion sp. Gn. Alab (SP13438) Microparmarion sp. Gn. Alab (SP13439) Microparmarion sp. Gn. Alab (SP13437) Microparmarion sp. Gn. Alab (SP13436) Microparmarion sp. Gn. Alab (SP13432) Microparmarion sp. Gn. Alab (SP 13435) Microparmarion sp. Gn. Alab (SP13434) Figure 6. EESI Molecular phylogenetic reconstruction for M. sallehi n. sp. (highlighted in blue) and other Bornean species of the genus Microparmarion. Numbers above branches are bootstrap values. Discussion Our phylogenetic analysis (Fig. 6) suggests that /. sallehi forms a distinct, monophyletic species, but one sample, TxEx-BR1901, although morphologically identical, is genetically somewhat divergent. This may be due to artifactual autapomorphic mutations in the sequence or the species may actually belong to a different, sympatric, closely-related species. For this reason, this specimen has not been used for the description and is not part of the type series. In northern Borneo, the genus Microparmarion appears to be more diverse than was suspected until recently. In an unpublished manuscript (Vermeulen, Schilthuizen & Liew, 2005, unpublished) for a guide for the land snails of Sabah, only two species were reported: M. simrothi Collinge & Godwin Austen, 1895 and M. pollonerai Collinge & Godwin Austen, 1895, both from montane forest. However, recent work has greatly augmented this number. Schilthuizen (2004) mentioned a possible species from the Crocker Range that he could not class with either of the previously-described species and Schilthuizen and Liew (2008) reported another undescribed species from Long Pa Sia. Schilthuizen et al. (2018) then described a lowland species, M. exquadratus, while also showing, in a phylogenetic A new semi-slug of the genus Microparmarion from Brunei, discovered, described ... 13 analysis of CO/ DNA-barcodes, that at least five more undescribed species were likely to be present in northern Borneo. Vermeulen and Liew (2022) then described the species previously reported by Schilthuizen (2004) as M. basifixus Vermeulen & Liew, 2022 and another species from lower montane forest of the Crocker Range as M. convolutus Vermeulen & Liew, 2022. The present paper adds another lowland species from Brunei, which may also occur in Sarawak and/or Sabah. Therefore, the total number of species of Microparmarion in northern Borneo may amount to more than ten, of which at least half remain to be described. Overall, Microparmarion species appear to be infrequently encountered. This may partly be due to true rarity, but also to the facts that their shells resist the commonly-used flotation techniques and that the living individuals are only seen during night or particularly wet weather. We would like to encourage malacologists working in Borneo and elsewhere in Southeast Asia to pay particular attention to these elusive semi-slugs, so that eventually sufficient material will be available for a genus-wide revision (a revision in which also related, possibly insufficiently circumscribed genera of the Ostracolethinae would need to be included). Interestingly, /. sallehi appears to be the most basal branching species of the genus. The other lowland species, VM. exquadratus, is quite distantly related and separated from WM. sallehi by several highland species. This might suggest that speciation in the genus has repeatedly been accompanied by elevational niche shifts, as described for other taxa in Borneo (Moyle et al. 2005,Merckx et al. 2015). However, bootstrap support values are very low, so further reconstructions of the phylogeny and niche evolution will have to await greater taxon sampling and the inclusion of additional genetic loci. Acknowledgements We thank the director, Dr. Hajah Norhayati binti Haji Anmad and staff members Assoc. Prof. Dr. Rahayu Sukmaria binti Haji Sukri, Assoc. Prof. Dr. Joeri Sergej Strijk, Dr. Siti Salwa binti Abdul Khalid, Awg. Teddy Chua Wee Li, Awg. Muhammad Salleh bin Abdullah Bat and Awg. Rodzay bin Haji Abdul Wahab of the Institute of Biodiversity and Environmental Research (IBER) at Universiti Brunei Darussalam (UBD) for facilitating our field course and expedition and to Agilah Shaqifah for supporting Werner de Gier during his work in the UBD collection and for providing collection numbers. We are also grateful to Prof. Dr. Ulmar Grafe and Dr. Dennis Ting Teck Wah for support. Other team members of the 2018, 2019 and 2022 field courses are thanked for their companionship and help. We thank Dr. Pierre Escoubas for producing the photographs in Fig. 3. References ° Edgar RC (2004) MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Research 32 (5): 1792-1797. https://doi.org/10.1093/nar/ gkh340 14 Schilthuizen M et al Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R (1994) DNA primers for amplification of mitochondrial cytochrome c oxidase subunit | from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3: 294-299. Goyes Vallejos J, Ulmar Grafe T, Anmad Sah H, Wells K (2017) Calling behavior of males and females of a Bornean frog with male parental care and possible sex-role reversal. Behavioral Ecology and Sociobiology 71 (6). https://doi.org/10.1007/s00265 -017-2323-3 Guindon S, Dufayard J, Lefort V, Anisimova M, Hordijk W, Gascuel O (2010) New algorithms and methods to estimate maximum-likelinood phylogenies: Assessing the performance of PhyML 3.0. Systematic Biology 59 (3): 307-321. https://doi.org/10.1093/ sysbio/syq010 Maestri S, Cosentino E, Paterno M, Freitag H, Garces JM, Marcolungo L, Alfano M, Njunjic |, Schilthuizen M, Slik F, Menegon M, Rossato M, Delledonne M (2019) A rapid and accurate MinlION-based workflow for tracking species biodiversity in the field. Genes 10 (6). https://doi.org/10.3390/genes10060468 Menegon M, Cantaloni C, Rodriguez-Prieto A, Centomo C, Abdelfattah A, Rossato M, Bernardi M, Xumerle L, Loader S, Delledonne M (2017) On site DNA barcoding by nanopore sequencing. PLOS One 12 (10). https://doi.org/10.1371/journal.pone.0184741 Merckx VFT, Hendriks K, Beentjes K, Mennes C, Becking L, Peijnenburg KCA, Afendy A, Arumugam N, de Boer H, Biun A, Buang M, Chen P, Chung AC, Dow R, Feijen FA, Feijen H, Soest CF, Geml J, Geurts R, Gravendeel B, Hovenkamp P, Imbun P, Ipor |, Janssens S, Jocqué M, Kappes H, Khoo E, Koomen P, Lens F, Majapun R, Morgado L, Neupane S, Nieser N, Pereira J, Rahman H, Sabran S, Sawang A, Schwallier R, Shim P, Smit H, Sol N, Spait M, Stech M, Stokvis F, Sugau J, Suleiman M, Sumail S, Thomas D, van Tol J, Tuh FY, Yahya B, Nais J, Repin R, Lakim M, Schilthuizen M (2015) Evolution of endemism on a young tropical mountain. Nature 524 (7565): 347-350. https://doi.org/10.1038/nature14949 Moyle R, Schilthuizen M, Rahman M, Sheldon F (2005) Molecular phylogenetic analysis of the white-crowned forktail Enicurus leschenaulti in Borneo. Journal of Avian Biology 36 (2): 96-101. https://doi.org/10.1111/j.0908-8857.2005.03510.x Murrell T, Bishop P, Abdul Wahab R, Grafe TU (2018) Lowland rainforest bat communities of Ulu Temburong National Park with two new records for Brunei Darussalam. Scientia Bruneiana 17 (1). https://doi.org/10.46537/scibru.v17i1.67 Schilthuizen M (2004) A checklist of the land snails of the Crocker Range. In: Mohamed M, Hamsah Z, Tachi T, Nais J (Eds) Crocker Range Scientific Expedition 2002. Universiti Malaysia Sabah, Kota Kinabalu. Schilthuizen M, Liew T- (2008) The slugs and semislugs of Sabah, Malaysian Borneo (Gastropoda, Pulmonata: Veronicellidae, Rathousiidae, Ariophantidae, Limacidae, Philomycidae). Basteria 72: 287-306. Schilthuizen M (2011) Community ecology of tropical forest snails: 30 years after Solem. Contributions to Zoology 80 (1): 1-15. https://doi.org/10.1163/18759866-0800 1001 Schilthuizen M, Clavera AP, Khoo MS, Bondar CA, Elder CHS, Bouma AM, Eddington TD, Reisinger C, Cosentino E, Rossato M, Delledonne M (2018) Bringing the lab to the field: a new lowland Microparmarion semi-slug (Gastropoda: Ariophantidae) described and DNA-barcoded in the forest. Journal of Molluscan Studies 85 (1): 35-40. https:// doi.org/10.1093/mollus/eyy052 A new semi-slug of the genus Microparmarion from Brunei, discovered, described ... 15 Simroth H (1893) Uber einige Parmarion-Arten. In: Weber M (Ed.) Zoologische Ergebnisse einer Reise in Niederlandisch Ost-Indien 3. E.J. Brill, Leiden. Vermeulen JJ, Liew TS (2022) Land snails and slugs of Sabah and Labuan (Malaysia). Universiti Malaysia Sabah, Kota Kinabalu, 432 pp. https://doi.org/10.6084/m9.figshare. 17156255