Dtsch. Entomol. Z. 70 (2) 2023, 337-355 | DOI 10.3897/dez.70.105870 Gye BERLIN Phylogeny of genus Sichuana Shen & Yin, 2020 (Orthoptera, Tettigonidae, Tettigoniinae) with four new species from Sichuan, China Jun-Jie Gul’, Chengjie Zheng!*, Su-Rong Jiang’, Yanli Yue! 1 College of Agronomy, Sichuan Agricultural University, Chengdu 611130, Sichuan, China https://zoobank. org/1292EF 4A-6967-45A5-8732-2F 980482DB00 Corresponding author: Yanli Yue (14332@sicau.edu.cn) Academic editor: Claudia Hemp @ Received 3 May 2023 Accepted 2 August 2023 @ Published 29 September 2023 Abstract Four new species of Sichuana Shen & Yin, 2020 are described based on morphological comparison and molecular analysis: S. planicercata sp. nov., S. curvicercata sp. nov., S. /ongilamina sp. nov. and S. magnicerca sp. nov. Specimens showed some intra- specific variation of male tegmina and subgenital plates. The genes CO/ and 16S were used to analyze the genetic distance between species and CO/ was used to analyze the phylogenetic relationship of Sichuana. Key Words Drymadusin1, genetic distance, revision, variation, veins Introduction The genus Sichuana Shen & Yin, 2020 (Tettigoniinae, Drymadusini) is endemic to Sichuan, China (Yin et al. 2020). It is comprised of two species, S. cryptospina Shen & Yin, 2020 and S. feicui He, 2020, in Wenchuan County and Mao County of western Sichuan (He et al. 2020). It is characterized by the following character states: lateral carina distinct in the metazona but faintly indicated on the prozona; prosternum with a pair of spines; female tegmina slightly longer than the length of the pronotum; male cerci strongly incurved in the middle, the apices are acute, and there is an inner tooth in the basal area of the male cerci. After morphological comparison, we revised the di- agnosis of Sichuana and described four new species: S. planicercata sp. nov., S. curvicercata sp. nov., S. longi- lamina sp. nov. and S. magnicerca sp. nov. We analyzed the genetic distances among species using the mitochon- drial genes CO/ and 16S and did a phylogenetic analysis of the genus based on COI. * These authors contributed equally to this work. Materials and methods Specimens and equipment The specimens were collected in western Sichuan, China. They (including holotypes) are deposited in the collection of the Department of Plant Protection of Sichuan Agricultural University (SICAU), Chengdu, China (Jun-Jie Gu, Curator). Photographs were taken using a SZX16 microscope system (Olympus, Tokyo, Japan), or a Cannon D550 with a 50 mm lens, composing by cellSens Dimension 3.2 software. The images were digitally stacked composites of approximately 20 focal planes using Helicon Focus 6 (http://www. heliconsoft.com accessed on 12 May 2022). Anatomical abbreviations Wing venation nomenclature is based on the interpreta- tion of Béthoux and Nel (2002) and Chivers et al. (2017): CuA, anterior cubitus; CuP, posterior cubitus; CuPaa, an- Copyright Jun-Jie Gu et a/. This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. 338 Jun-Jie Gu et al.: Phylogeny of Sichuana with four new species terior branch of first posterior cubitus; CuPaB, posterior branch of first posterior cubitus; CuPb, second posterior cubitus; MA, anterior media; MP, posterior media; RA, anterior radius; RP, posterior radius; ScA, anterior sub- costa; ScP, posterior subcosta. “Handle” describes the strong crossvein appearing as a main vein between the origin of CuA + CuPaa and CuPaf. DNA extraction and amplification. Genomic DNA was extracted from the muscles of one hind leg using a CWBIO Universal Genomic DNA Kit by the manufacturer’s instructions. The molecular markers select- ed for this paper were mitochondrial cytochromec 0 xidase subunit I gene (CO/) and the mitochondrial large-subunit rRNA gene (16S).The primers used are shown in Table 1 (Xiong and Kocher 1991; Pan et al. 2006). GenBank ac- cession numbers are showed in Table 2. Table 1. Primer sequences. Target genes COI Sequences COBL TYTCAACAAAYCAY AARGATATTGG COBU TAAACTTCWGGRTGWCCAAARAATCA 16S 16Sa CGCCTGTTTATCAAAAACAT 16Sb CTCCGGTTTGAACTCAGATCA The CO/ and 16S sequences isolated from all samples were used for phylogenetic assay (Table 2) (Yin et al. 2020; Liu et al. 2018). All fragments were trimmed using Seqmen in DNAstar (Echeverry et al. 2017), and were aligned in MEGA11 by ClustalW (Tamura et al. 2021). Genetic distance analysis COI and 16S were used for this analysis (Table 2). Estimation of genetic distance was conducted by MAGE11. Table 2. GenBank accession number. Taxon COI 16S Reference Sichuana magnicerca 0Q799533 OQ801125 _ this study sp. nov. 1 S. magnicerca sp. nov. 2 0Q799537 OQ801126 _ this study S. magnicerca sp. nov. 3 0Q799534 OQ801127 _ this study S. magnicerca sp. nov. 4 0Q799532 OQ801128 _ this study S. magnicerca sp. nov. 5 — OQ801129 _ this study S. longilamina sp. nov. 0Q799531 OQ801133 _ this study S. feicui 0Q799536 OQ801124 _ this study S. planicercata sp. nov. | 0Q799525 OQ801130 _ this study S. planicercata sp. nov. 2 0Q799526 OQ801131 _ this study S. planicercata sp. nov. 3 0Q799527 OQ801132 _ this study S. planicercata sp. nov.4 O0Q799528 — this study S. curvicercata sp. nov.1 0Q799529 OQ801121 _ this study S. curvicercata sp. nov.2 0Q799530 OQ801122 this study S. curvicercata sp. nov. 3 — 0Q801123 this study S. cryptospina | MT161464 — Yin et al. 2020 S. cryptospina 2 MT161465 — Yin et al. 2020 Mongolodectes huangxinleii_ MT161460 = Yin et al. 2020 Atlanticus fengyangensis MG787210 S Liu et al. 2018 dez.pensoft.net We selected “compute pairwise distances” for comparing Sichuana species and used the “bootstrap method” with 1000 bootstrap replicates in the variance estimation method, then analyzed the data by the Kimura-2-parameter model. Molecular phylogenetic analysis COI was used for this analysis (Table 2). 1. huangxinleii Liu, Xu & Zhang, 2015 and A. fengyangensis Liu, 2013 were used as outgroups. In all three datasets, the species of Sichuana Yin & Shen, 2020 were treated as ingroups. Phylogenetic analysis was conducted using MrBayes 3.2.7 (Ronquist et al. 2012) for Bayesian inference (BI) and IQ-tree 1.6.2 (Nguyen et al. 2015) for maximum-like- lihood (ML). In the BI analysis, four chains were run for 1,000,000 generations, sampling every 1,000 generations and taking the first 25% of the trees as burn-in. In the ML analysis, the best model obtained by IQ-tree1.6.2 was TVM+F+I, a total of 10000 ultrafast bootstrap replicates were executed before a thorough ML search. Species distribution map The satellite maps were sourced from the National Plat- form for Common Geospatial Information Services (https://www.tianditu.gov.cn/) and edited with ArcGIS 10.8 (Esri 2011). The distribution of Sichuana species is shown in Fig. 1. Results Systematics Orthoptera: Tettigoniidae: Tettigoniinae: Drymadusini Genus Sichuana Shen & Yin, 2020 Emended diagnosis. Differs from all other Drymadusini genera in China by its male cercus being strongly incurved at or after its middle with acute apex, with a basal inner tooth (Figs 2, 6, 9, 12); median carina faintly indicated in prozona and absent in metazona; male tegmen about twice as long as pronotum; and female tegmen equal to or slightly longer than pronotum. Furthermore, Sichuana differs from Uvarovina Ramme, 1939, Ptosoproctus Shen, Yin & He, 2021, and Eulithoxenus Bey-Bienko, 1951 by its proster- num with a pair of spines (Figs 4, 8, 11, 14). Differs from Atlanticus Scudder, 1894, Eulithoxenus, Ptosoproctus, and Uvarovina by its ovipositor being decurved (Figs 2, 6, 9, 12). Differs from Adtlanticus, Eulithoxenus, Mongolodectes Bey-Bienko, 1951, Paratlanticus Ramme, 1939, Ptoso- proctus, and Uvarovina by its lateral carina being distinct in metazona and faintly tndicated on prozona (Figs 2, 6, 9, 12). Differs from Kansua Uvarov, 1933, Paratlanticus, Ceraeocercus Uvarov, 1910 by dorsal side of protibia only Dtsch. Entomol. Z. 70 (2) 2023, 337-355 103°0'0"E 102°30'0 103°30'0"E 104° "E 0'0"E S. magnicerca sp. nov. [jj S. cryptospina [j S. longilamina sp. nov. 104°30'0"E 255'0" 7 103°50"E 0" E @S. planicercata sp. nov.@S. curvicercata sp. nov. AS. feicui 102°35'0" E 103°0'0" E 103°10'0" E 103°15'0"E Figure 1. A. Distribution of Sichuana species in Sichuan Province, China; B, C. Enlarged version of Sichuana species distribution; B. S. planicercata sp. nov. and S. curvicercata sp. nov.; C. S. longilamina sp. nov. and S. magnicerca sp. nov. (circles, squares and triangles represent the three clades on the phylogenetic tree). with external spurs, and dorsal side of mesotibia with spurs on both sides. Differs from Kansua Uvarov, 1933 by its smooth pronotum (Heller and Liu 2016; Liu 2013; Liu 20153 bivretalt.2019=Shenet-al. 2021). Type species. Sichuana cryptospina Shen & Yin, 2020. Sichuana planicercata Gu, Zheng & Yue, sp. nov. https://zoobank. org/B79B73BD-FB84-485C-B8C A-B4A8E54FA AEF4 Material examined. Holotype: 4, Xiaojin County, Nga- wa Tibetan and Qiang Autonomous Prefecture, Sichuan Province, China, (30°59'31"Ny» 102°2139"E, alt..-:ca:; 2700 m), coll. Cheng-Jie Zheng and Yuan Wei, VIII- 2022. Paratypes:10¢ 59, same data as in holotype. Diagnosis. Differs from all other Sichuana species by its male tenth abdominal tergite with a pair of very short round projections at posterior margin (Fig. 2F); male cer- cus without distinct curve upward or downward (Fig. 2E, F, H), inner tooth far above the top of cercus in lateral view (Fig. 2 H); and lacuna of female tenth abdominal tergite rounded and deep, reaching to or near posterior margin of ninth abdominal tergite (Fig. 2G).The related species S. curvicercata sp. nov. with narrower lateral field of male tegmen and simple male tenth abdominal tergite, thus be- ing similar to S. planicercata sp. nov. (Fig. 61, F). Etymology. The specific epithet is derived from a combination of the Latin ‘p/ani’ meaning flat, and ‘cer- cus’, describing the male cerci not bent ventrally or dor- sally. Chinese name: *¥ /%) || &&. Measurements (mm). Body (head to tip of abdomen): 32.4-33.86¢9, 34.22-35.839: pronotum: 8.26-8.98¢, 7.86-8.469; tegmen: 15.39-16.214), 7.96-9.359: mirror of right tegmen (from fore to hind): 4.23-4.42<'; hind wing: 6.12-6.906', 5.43-5.762: protibia: 8.86-9.36¢, 8.85-10.319; profemur: 7.68-8.04¢4', 7.92-8.539; me- sotibia: 9.18-10.584, 9.96-11.289; mesofemur: 8.47— 9.013, 8.48-9.429; metatibia: 21.09-22.71¢, 22.39- 23.249; metafemur: 21.61-22.7146; 22.98-23.769; Ovipositor: 20.82—21.43. Description. Male. Body, large. Frons flat, slightly oblique. Frontal fastigium and clypeofrontal sulcus black. Face light-colored. Occiput convex. Vertical fastigium broad, slightly wider than scape. Median ocellus visible. Compound eyes broadly round and bulging outwards, surrounded by black coloration that extends backward to form a band. Antennae inserted at the inner sides of the compound eyes, scapus robust, much thicker than pedi- cel, flagellum tapers toward the apex, covered with short setae (Fig. 2A—D). Pronotum saddle-shaped, smooth, nearly equal to profemur in length. Disc of prozona with a broadly ob- tuse concavity in the middle of each side, anterior mar- gin of pronotum slightly concave and posterior margin blunt, median carina faintly indicated in prozona, absent in metazona, lateral carina distinct in metazona, faint- ly indicated in prozona. Lateral lobe of pronotal length greater than depth, with a light-colored stripe along the lateral margin, sometimes not obvious, humeral sinus obvious (Fig. 2A—D). Prosternum with a pair of small cone-shaped spines (Fig. 4E). Mesosternum with a pair of triangular lobes, nearly equal in width to height. Metasternum with a pair of rounded triangular lobes, width distinctly greater than height (Fig. 4E). Thoracic auditory spiracle elongated and elliptical, partially cov- ered by lateral lobe of pronotum. dez.pensoft.net 340 Figure 2. A-D. Body of Sichuana planicercata sp. nov. A, B. Male holotype; C, D. Female paratype; A, C. Dorsal view; Jun-Jie Gu et al.: Phylogeny of Sichuana with four new species 5mm er ae B, D. Lateral view; E. Male terminal abdomen with artificially unfurled cerci in dorsal view for showing inner tooth; F. Male terminal abdomen in dorsal view; G. Female terminal abdomen in dorsal view; H. Male terminal abdomen in lateral view; I. Male left tegmen in lateral view. Tegmen approximately equal to, or slightly shorter than, twice length of pronotum, with clear longitudinal and cross veins. Tegmen folded downward along the M+CuA, flat dorsal field with a transverse lacuna in the middle. Tegmen almost the same width as the metazona disc from base to middle, then gradually narrowing in dorsal view. Lateral field of the tegmen slightly broadened (Fig. 21). ScA weak and short, very close to anterior margin, ended at or before the middle of the anterior margin. ScP strong, with 4—6 branches. R forked to RA and RP very distally or without distinct dichotomy (Fig. 3B), sometimes distal- ly fused with ScP then separated immediately (Fig. 3A). M+CuA separated to M and CuA after the origin of the dez.pensoft.net handle, but the position of their separation is unstable. M forked to MA and MP distally (Fig. 3A—F). Stridulatory file with about 20 teeth (Fig. 4G). Mirror on right tegmen pentagonal, its length greater than its width (Fig. 3B, D, F). Hind wing rudimentary. Legs. Prothoracic leg: genicular lobes of pro- and me- sothoracic leg usually unarmed on both sides, sometimes armed with 1—2 spinules; dorsal procoxa with a long spine; profemur with 0-2 external black spinules and 14 internal black spinules ventrally; protibia with a slit-like tympanum on both sides; protibia with 2—3 external spurs dorsally, with 4—5 spurs on each side ventrally; protibia with an external apical spur dorsally and a pair of apical 341 Dtsch. Entomol. Z. 70 (2) 2023, 337-355 A poe | Sek rae fi MeCaAN } : : fens oN OG CuPafs C freeN. A rpc i Cura fanele CuPap E . ScA fice MituAS CuPa~ CuPap fiat 4mm spurs ventrally. Mesothoracic leg: mesofemur with 14 external black spinules and 0-2 internal black spinules ventrally; mesotibia with 24 external spurs and 34 in- ternal spurs dorsally, with 5—6 spurs on each side ven- trally; mesotibia with an internal apical spur dorsally and with a pair of apical spurs ventrally. Metathoracic leg: metafemur with sparse black spinules on each side ven- trally; metatibia with a row of spines of different sizes on each side dorsally, with a row of sparse tiny spurs on each side ventrally, progressively denser toward apex; metati- bia with a pair of apical spurs dorsally, with two pairs of apical spurs ventrally, one pair distinctly larger. The apical area of the tenth abdominal tergite with a wide and pileous lacuna in the middle, covered with many tiny granular protrusions; posterior margin of tenth abdominal tergite with a shallow notch at the middle of the posterior margin, sides of which form a pair of very short round projections (Fig. 2F). Cercus conical and pil- eous, strongly incurved after the middle of itself, apex acute, not bent toward dorsal or ventral side. Presence of a hook-like and incurved inner tooth at base of cercus, tapering and curving from base to apex; inner teeth far M+CuA’ =i A. a ' yo uPa’ \ - handle SM ACUAS fred M CuPa’ @” Figure 3. A-F, Tegmina of Sichuana planicercata sp. nov. in dorsal view. A, C, E. Left tegmina; B, D, F. right tegmina. above top of cercus in lateral view (Fig. 2E, F, H). Subge- nital plate length greater than width, slightly beyond cer- cus; with lateral carinae, middle part of posterior margin with a deep notch; width of notch varies; stylus slender and longer than notch (Fig. 4A—C). Epiproct triangular. Titillator L-shaped, with 2—3 rows of larger denticles, gradually decreasing from base to apex in apical portion (Fig. 4F). Female. Generally similar to male, but body slightly larger. Tegmen slightly longer or shorter than pronotum, extending to the third abdominal tergum (Fig. 2B, D). Hindwing micropterous, longer than half of pronotum. Cercus conical and pileous. Tenth abdominal tergite with a wide rounded deep lacuna in the middle, reaching to or near posterior margin of ninth abdominal tergite (Fig. 2G). Subgenital plate nearly trapezoid, its width greater than length, middle of posterior margin with a wide notch (Fig. AD). Ovipositor slightly shorter than metafemur, straight or slightly decurved distally (Fig. 2B, D). Remarks. S. planicercata sp. nov., can be assigned to Sichuana Shen & Yin, 2020 by its median carina faint- ly indicated in the prozona and absent in the metazona; dez.pensoft.net 342 Jun-Jie Gu et al.: Phylogeny of Sichuana with four new species Figure 4. Sichuana planicercata sp. nov. A-C. Male subgenital plate; D. Female subgenital plate; E. Thorax in ventral view; F. Titillator; G. Stridulatory file on underside of male left tegmen. lateral carina distinct in metazona, faintly indicated in prozona; prosternum with a pair of spines; male tegmina mesopterous, far exceeding pronotum; male cerci coni- cal, strongly incurved at middle, apex acute, and with an inner tooth placed in basal area. S. planicercata sp. nov. is similar to S. curvicercata sp. nov., but differs distinctly by: male cerci not bending ven- trally or dorsally, while those of S. curvicercata sp. nov. are curved ventrally with apex pointing dorsally; a hook- like inner tooth that tapers and curves from base to apex, extending far above the top of cerci in lateral view, while S. curvicercata sp. nov. having almost the same thickness overall and suddenly sharp and incurved at apex, slightly above the top of the cerci in lateral view; the posterior margin of the male tenth abdominal tergite has a shallow notch at the middle of the posterior margin, and its sides form a pair of very short round projections, while that of S. curvicercata sp. nov. 1s without protrusion, only a wide and shallow notch at the middle (Figs 2E, F, 6E, F); denticles on the apical portion of the titillator of S. dez.pensoft.net planicercata sp. nov. are fewer and sparser than those of S. curvicercata sp. nov. and are relatively larger (Figs 4F, 8F); S. planicercata sp. nov. has slightly more stridulato- ry teeth than S. curvicercata sp. nov., and the spacing of the teeth of S. planicercata sp. nov. is slightly narrower than that of S. curvicercata sp. nov. (Figs 4G, 8G); and female tenth abdominal tergite has a wide rounded deep lacuna in the middle that reaches the posterior margin of the ninth abdominal tergite, while that of S. curvicercata sp. nov. has a wide trapezoidal projection at the posterior margin (Figs 2G, 6G). S. planicercata sp. nov. differs from S. feicui He, 2020 and S. cryptospina Shen & Yin, 2020 by the following character states: the lateral field of the male tegmina is only slightly broadened; in the male tegmina, M+CuA is separated to M and CuA after the origin of the handle; the male cerci are strongly incurved after their middle; a hook-like inner tooth is far above the top of the cerci in lateral view; and the pair of projections at the posterior margin of the male’s tenth abdominal tergite is very short Dtsch. Entomol. Z. 70 (2) 2023, 337-355 and inconspicuous. These two species also differ from S. planicercata sp. nov. in the shape of the inner teeth, the denticles on the titillator, the morphology of the female tenth abdominal tergite, the shape of the stridulatory file, and the number of stridulatory teeth. Sichuana curvicercata Gu, Zheng & Yue, sp. nov. https://zoobank. org/EA8A23D6-8FDD-46B0-9C CO-C6FF514353C6 Material examined. Holotype: ¢, Yonghong_ vil- lage, Dawei town, Xiaojin County, Ngawa Tibetan and Qiang Autonomous Prefecture, Sichuan Province, China (30°58'6"N, 102°38'16"E, alt., ca. 2800 m), coll. Cheng- Jie Zhengand Yuan Wei, VIII-2022. Paratypes: 103 19, same data as in holotype (Fig. 5). Diagnosis. Differs from all other Sichuana species by male tenth abdominal tergite without projections at posterior margin (Fig. 6F); male cercus gradually curved ventrally with apex pointing dorsally (Fig. 6E, F, H), in- ner tooth thick and nearly straight, suddenly sharp and incurved at apex (Fig. 6E); female tenth abdominal terg- ite with a wide trapezoidal projection at posterior margin (Fig. 6G). Etymology. The specific epithet is derived from a combination of the Latin ‘curvi’? meaning curved and ‘cercus’, describing the male cerci curved ventrally with the apex pointing dorsally. Chinese name: 2 é)!] im. bes*'> = | ~« a 343 Measurements (mm). Body (head to tip of abdomen): 25.36-26.774, 27.282: pronotum: 6.98-7.263, 7.449; tegmen: 11.70-12.42¢, 7.089; mirror of right tegmen (from fore to hind): 3.88-3.963'; hind wing: 4.39-4.62¢, 4.792; protibia: 6.24-7.23¢, 7.62: profemur: 6.45— 6.863, 7.289: mesotibia: 7.24-7.723', 9.329; mesofemur: 6.26-7.103, 8.162; metatibia: 16.33-17.194', 19.929; metafemur: 17.56-17.8¢'; 20.969; ovipositor: 17.64. Description. Male. Body size medium. Frons flat, slightly oblique. Frontal fastigium and clypeofrontal sul- cus black. Face light-colored. Occiput convex. Vertical fastigium broad, slightly wider than scape. Median ocel- lus visible. Compound eyes broadly round and bulging outwards, surrounded by black coloration that extends backward to form a black band. Filiform antennae insert- ed at the inner side of the compound eyes, scapus robust, much thicker than pedicel, flagellum taper toward the apex, covered with short setae (Fig. 6A—D). Pronotum saddle-shaped, smooth, nearly equal to pro- femur in length. Disc of prozona with a broadly obtuse concavity in the middle of each side, anterior margin of pronotum slightly concave and posterior margin blunt, median carina faintly indicated in prozona, absent in meta- zona, lateral carina distinct in metazona, faintly indicated in prozona. Lateral lobe of pronotal length greater than depth, with a light-colored stripe along the lateral margin, sometimes not obvious, humeral sinus obvious (Fig. 6A— D). Prosternum with a pair of small cone-shaped spines Figure 5. Sichuana curvicercata sp. nov. A. Adult female; B—D. Adult male. dez.pensoft.net lmm Jun-Jie Gu et al.: Phylogeny of Sichuana with four new species = F Figure 6. A-D. Body of Sichuana curvicercata sp. nov. A, B. Male holotype; C, D. Female paratype; A, C. Dorsal view; B, D. Lateral view; E. Male terminal abdomen with artificially unfurled cerci in dorsal view for showing inner tooth; F. Male terminal abdomen in dorsal view; G. Female terminal abdomen in dorsal view; H. Male terminal abdomen in lateral view; I. Male left tegmen in lateral view. (Fig. 8E). Mesosternum with a pair of triangular lobes, nearly equal in width to height. Metasternum with a pair of rounded triangular lobes, width distinctly greater than height (Fig. 8E). Thoracic auditory spiracle elongated and elliptical, partially covered by lateral lobe of pronotum. Tegmen approximately equal to or slightly shorter than twice length of pronotum, with clear longitudinal and cross veins. Tegmen folded downward along M+CuA, dorsal field flat, with a transverse lacuna in the middle. Tegmen almost the same width with disc of metazona from basic until middle, and then gradually narrowing in dorsal view. Lateral field of tegmen slightly broadened (Fig. 61). ScA weak and short, very close to anterior mar- gin, ending at or before middle of anterior margin. ScP strong, with 5—7 branches. R without distinct dichotomy. dez.pensoft.net M+CuA separated into M and CuA after intersection of handle and M+CuA, slightly after middle of tegmen. M separated into MA and MP after origin of handle but the position of their separation is unstable (Fig. 7A—F). Strid- ulatory file with about 18 teeth (Fig. 8G). Mirror on right tegmina pentagonal, length greater than width (Fig. 7B, D, F). Hind wing rudimentary. Legs. Prothoracic leg: genicular lobes armed with 1—2 internal spinules and externally unarmed. Dorsal side of procoxa with a long spine. Profemur with 2—4 internal black spinules ventrally; protibia with a slit-like auditory tympanum on both sides; protibia with 0-3 ex- ternal spurs dorsally, with 4-5 spurs on each side ven- trally; protibia with an external apical spur dorsally and with a pair of apical spurs ventrally. Mesothoracic leg: Dtsch. Entomol. Z. 70 (2) 2023, 337-355 ail M+Cuay ms CuPrax handle), CuPap oe MsCuAg CuP a GuPap fondle 345 yMFCuA freeM Y2M+CudA fr : Be 3mm Figure 7. A-F. Tegmina of Sichuana curvicercata sp. nov. in dorsal view. A, C, E. Left tegmina; B, D, F. Right tegmina. genicular lobes armed with 0—2 spinules on each side. Mesofemur with 2-4 external black spinules and 0-2 internal black spinules ventrally; mesotibia with 2-4 ex- ternal spurs and 3—4 internal spurs dorsally, with 5-6 spurs on each side ventrally; mesotibia with an internal apical spur ventrally and a pair of apical spurs dorsally. Metathoracic leg: genicular lobes unarmed; metafemur with sparse black spinules on each side ventrally; metat- ibia with a row of spines of different sizes on each side dorsally, with a row of sparse tiny spurs on each side ventrally, progressively denser toward apex; metatibia with a pair of apical spurs dorsally and two pairs ventral- ly, one of which is distinctly larger. The apical area of the tenth abdominal tergite with a wide and pileous lacuna in the middle, covered with many tiny granular protrusions. The tenth abdominal tergite with a wide and shallow notch in the middle of the posterior margin (Fig. 6F). Cercus conical and pile- ous, strongly incurved at middle; cercus curved ventrally after the middle, with the apex pointing dorsally. With a thick and nearly straight inner tooth at the base of the cer- cus, almost the same thickness overall, its apex abruptly thin and incurved; inner tooth slightly above the top of cercus in lateral view (Fig. 6E, F, H). Subgenital plate length greater than width, with lateral carinae, middle part of posterior margin with a deep notch, width of notch varies; stylus slender and longer than notch (Fig. 8A—C). Epiproct triangular. Titillator L-shaped, with 5—6 rows of dense denticles or more, gradually decreasing from base to apex on apical portion (Fig. 8F). Female. Generally similar to male, but body slightly larger. Tegmen shorter than pronotum, extending to the third abdominal tergum (Fig. 6B, D). Hindwing microp- terous, longer than half of pronotum. Cercus conical and pileous. The posterior margin of tenth abdominal tergite with a wide trapezoidal projection (Fig. 6G). Subgenital plate nearly trapezoid, width nearly equal to length, mid- dle of posterior margin with a wide notch (Fig. 8D). Ovi- positor slightly shorter than metafemur, slightly decurved distally (Fig. 6B, D). Remarks. S. curvicercata sp. nov. 1s similar to S. plan- icercata sp. nov., but is distinct by: male cerci gradually dez.pensoft.net 346 Jun-Jie Gu et al.: Phylogeny of Sichuana with four new species Figure 8. Sichuana curvicercata sp. nov. A-C. Male subgenital plate; D. Female subgenital plate; E. Thorax in ventral view; F. Titillator; G. Stridulatory file on underside of male left tegmen. curved ventrally with the apex pointing dorsally, while those of S. planicercata sp. nov. do not bend ventrally or dorsally; the inner tooth is nearly straight and almost fo same thickness overall and is suddenly sharp and in- curved at apex, while that of S. planicercata sp. nov. is tapering and curving from base to apex and is far above the top of the cerci in lateral view; the posterior margin of the male tenth abdominal tergite only with a wide and shallow notch in the middle of the posterior margin, while that of S. planicercata sp. nov. has a pair of very short and inconspicuous projections (Figs 2E, F, 6E, F); denticles on the apical portion of titillator of S. planicercata sp. nov. are fewer and sparser than those of S. curvicercata sp. nov. and are relatively larger (Figs 4F, 8F); S. cur- vicercata sp. nov. with slightly fewer stridulatory teeth than S. planicercata sp. nov., and the spacing of the teeth of S. curvicercata sp. nov. is slightly wider than that of S. planicercata sp. nov. (Figs 4G, 8G); female tenth abdom- inal tergite with a wide trapezoidal projection at the pos- terior margin, while that of S. planicercata sp. nov. have a wide rounded deep lacuna in the middle (Figs 2G, 6G). S. curvicercata sp. nov. differs from S. feicui He, 2020 and S. cryptospina Shen & Yin, 2020 by: the lateral field dez.pensoft.net of the male tegmina is slightly broadened; in male teg- mina, M+CuA separate to M and CuA after the origin of the handle; the posterior margin of the male tenth abdom- inal tergite is without projections; male cerci are curved ventrally with the apex pointing dorsally. Furthermore, S. curvicercata sp. nov. differs from S. feicui by its male cerci strongly incurved at the middle. These two species also differ from S. curvicercata sp. nov. in the shape of the inner teeth, the denticles on the titillator, the morphol- ogy of the female tenth abdominal tergite, the shape of the stridulatory file, and the number of stridulatory teeth. Sichuana longilamina Gu, Zheng & Yue, sp. nov. https://zoobank.org/0B23FBDC-D40A-4AE2-957A-982FB4F64E4D Material examined. Holotype: ¢, Guergou, Li County, Ngawa Tibetan and Qiang Autonomous Prefecture, Sich- uan Province, China, (31°30'29"N, 102°58'35"E, alt., ca. 2400 m), coll. Cheng-Jie Zhengand Yuan Wei, VHI-2022. Paratypes: 1°, same data as in holotype. Diagnosis. Differs from all other Sichuana species by notch of tenth abdominal tergite of male trapezoidal (Fig. Dtsch. Entomol. Z. 70 (2) 2023, 337-355 347 Figure 9. A-D. Body of Sichuana longilamina sp. nov. A, B. Male holotype; C, D. Female paratype; A, C. Dorsal view; B, D. Lateral view; E. Male terminal abdomen with artificially unfurled cerci in dorsal view for showing inner tooth; F. Male terminal abdomen in dorsal view; G. Female terminal abdomen in dorsal view; H. Male terminal abdomen in lateral view; I. Male left tegmen in lateral view. 9 F); male cercus strongly incurved at an acute angle and pointing dorsally (Fig. 9E, F, H), inner tooth pointing dor- sally (Fig. 9E); apex of male subgenital plate elongate, the long styli about one-third of length of subgenital plate (Figs 9H, 11C); notch of female tenth abdominal tergite trapezoidal (Fig. 9G). Etymology. The specific epithet is derived from a combination of the Latin ‘/Jongus’ meaning long and ‘lamina meaning plate, to describe its male subgenital plate which is distinctly longer than the cerci. Chinese name: 1c 4x)! ii. Measurements (mm). Body (head to tip of abdomen): 27.74, 31.389; pronotum: 8.364, 8.62: tegmen: 17.424, 8.762: mirror of right tegmen (from fore to hind): 4.34; hind wing: 7.824, 5.549; protibia: 7.583, 109: profe- mur: 7.44, 8.59; mesotibia: 9.424, 10.942: mesofemur: 8.529, 9.629; metatibia: 21.124, 26.289; metafemur: 20.984; 25.649; ovipositor: 23.34. Description. Male. Body size medium. Frons flat, slightly oblique. Frontal fastigium and clypeofrontal sulcus black. Face light-colored. Occiput convex. Verti- cal fastigium broad, slightly wider than scape. Median ocellus visible. Compound eye broadly round and bulg- ing outwards, surrounded by black coloration extending backward to form a band. Filiform antennae inserted on the inner sides of the compound eyes, scapus robust, dez.pensoft.net Jun-Jie Gu et al.: Phylogeny of Sichuana with four new species Figure 10. A, B. Tegmina of Sichuana longilamina sp. nov. in dorsal view. A. Left tegmen; B. Right tegmen. much thicker than pedicel, flagellum tapers toward the apex, covered with short setae (Fig. 9A—D). Pronotum saddle-shaped, smooth, nearly equal to profemur in length. Disc of prozona with a broadly ob- tuse concavity in the middle of each side, anterior mar- gin of pronotum slightly concave and posterior margin blunt, median carina faintly indicated in prozona, absent in metazona, lateral carina distinct in metazona, faint- ly indicated in prozona. Lateral lobe of pronotal length greater than depth, with a light-colored stripe along the lateral margin, sometimes not obvious, humeral sinus obvious (Fig. 9A—D). Prosternum with a pair of longer cone-shaped spines (Fig. 11A). Mesosternum with a pair of acute triangular lobes, height greater than width. Metasternum with a pair of rounded triangular lobes, width distinctly greater than height (Fig. 11E). Thoracic auditory spiracle elongated and elliptical, partially cov- ered by lateral lobe of pronotum. Tegmen slightly shorter than twice the length of pro- notum, with clear longitudinal and cross veins. Tegmen folded downward along the M+CuA, the dorsal field flat, with a transverse lacuna in the middle. Tegmen almost the same width as disc of metazona from base to the mid- dle, then gradually narrowing in dorsal view. Lateral field of the tegmen distinctly broadened (Fig. 91). ScA weak, very close to anterior margin, ending at the middle of the anterior margin or fused with branch of ScP. ScP strong, with 3—5 branches. R forked to RA and RP distally, RA very close to ScP, sometimes distally fused with ScP (Fig. 10B). M+CuA branched to M and CuA before intersec- tion of handle and CuA, slightly before middle of tegmen. M forked to MA and MP before the origin of the handle, but position of their separation unstable (Fig. 10A, B). Stridulatory file with about 34 teeth (Fig. 11E). Mirror on right tegmina pentagonal, length greater than width (Fig. 10B). Hind wing rudimentary. Legs. Prothoracic leg: genicular lobes armed with 1—2 internal spinules and externally unarmed. Dorsal procoxa with a long spine. Profemur with 2—4 internal black spinules ventrally; protibia with a slit-like auditory tympanum on both sides; protibia with 2 external spurs dorsally, with 5 spurs on each side ventrally; protibia with an external apical spur dorsally and with a pair of apical dez.pensoft.net spurs ventrally. Mesothoracic leg: genicular lobes armed with O—1 external spinule and | internal spinule; mesofe- mur with 2-3 external black spinules and 0-2 internal black spinules ventrally; mesotibia with 2 external spurs and 3 internal spurs dorsally, with 5 spurs on each side ventrally; mesotibia with an internal apical spur dorsal- ly and with a pair of apical spurs ventrally. Metathorac- ic leg: genicular lobes unarmed; metafemur with sparse black spinules on each side ventrally; metatibia with a row of spines of different sizes on each side dorsally, with a row of sparse tiny spurs on each side ventrally, pro- gressively denser toward the apex; metatibia with a pair of apical spurs dorsally, with two pairs of apical spurs ventrally, one pair distinctly larger. The apical area of the tenth abdominal tergite with a wide lacuna in the middle covered with many tiny gran- ular protrusions. The posterior margin of the tenth ab- dominal tergite with a trapezoidal notch at the middle, its sides forming a pair of round, blunt lobes (Fig. 9E, F). Cercus conical and pileous, strongly incurved at an acute angle after its middle and points dorsally, apex acute; with a hook-like, incurved inner tooth placed at base of cercus, tapering and curving from the base to the apex and pointing dorsally (Fig. 9E, F, H). Subgenital plate length greater than width, with lateral carinae, middle posterior margin with a deep notch, apex of subgenital plate elongate, far beyond cercus; stylus slender, about one-third the length of subgenital plate, longer than notch (Fig. 11C). Epiproct triangular. Titillator L-shaped, with 2-3 rows of denticles, and denticles on upper part of the apical portion distinctly larger than those on the lower part (Fig. 11D). Female. Generally similar to male, but body slightly larger. Tegmen shorter than pronotum, extending to the third abdominal tergum (Fig. 9C, D). Hindwing microp- terous, longer than half of the pronotum. Cercus conical and pileous. The apical area of the tenth abdominal tergite with a wide depression in the middle, near the posteri- or margin of ninth abdominal tergite. Tenth abdominal tergite with a U-shaped excision in the middle of poste- rior margin, sides of excision form a pair of round blunt projections (Fig. 9G). Subgenital plate nearly trapezoid, width greater than length, middle of posterior margin Dtsch. Entomol. Z. 70 (2) 2023, 337-355 349 D apical portion Figure 11. Sichuana longilamina sp. nov. A. Thorax in ventral view; B. Female subgenital plate; C. Male subgenital plate; D. Titillator; E. Stridulatory file on underside of male left tegmen. with a wide notch (Fig. 11B). Ovipositor slightly shorter than metafemur, slightly decurved distally (Fig. 9C, D). Remarks. S. /ongilamina sp. nov. differs from S. feicui He, 2020, S. cryptospina Shen & Yin, 2020, S. planic- ercata sp. nov. and S. curvicercata sp. nov. by the fol- lowing: pair of cone-shaped spines on prosternum more slender; pair of lobes on mesosternum acutely triangular, height greater than width (Fig. 11 A); male cerci strong- ly incurved at an acute angle slightly after their middle and gradually curved dorsally (Fig. 9E, F, H); apex of male subgenital plate extended far beyond cerci (Figs 9H, 11C); styli longer, about one-third the length of subgeni- tal plate (Fig. 11C). Furthermore, S. /ongilamina sp. nov. differs from S. planicercata sp. nov. and S. curvicercata sp. nov. by: tenth abdominal tergite with a pair of round blunt projections on posterior margin; in male tegmina M+CuA branching to M and CuA before origin of handle; lateral field of male tegmina distinctly broadened. These four species also differ from S. /ongilamina sp. nov. in the shape of the inner teeth, the denticles on the titillators, the morphology of the tenth abdominal tergite, the shape of the stridulatory file, and the number of strid- ulatory teeth. Sichuana magnicerca Gu, Zheng & Yue, sp. nov. https://zoobank. org/532D02B3-2225-46C3-9DC9-2EB 1918373A2 Material examined. Holotype: ¢, Zagunao town, Li County, Ngawa Tibetan and Qiang Autonomous Prefecture, Sichuan Province, China, (31°27'33"N, 103°10'52"E, alt., ca. 2000 m), coll. Cheng-Jie Zheng and Yuan Wei, VIIH-2022. Paratypes: 83 119, same data as in holotype. Diagnosis. Differs from all other Sichuana species by notch of male tenth abdominal tergite U-shaped; large and long male cercus beyond subgenital plate (Fig. 12F, H), inner tooth small, inserted in the most basal part of cer- cus (Fig. 12E); notch of female tenth abdominal tergite V-shaped (Fig. 12G). The related species S. cryptospina Shen & Yin, 2020 with a pair of projections covering the inner tooth at male tenth abdominal tergite, male cercus at an obtuse angle, and broader lateral field of male tegmen, thus being similar to S. magnicerca sp. nov. (Fig. 12). Etymology. The specific epithet is derived from a combination of the Latin ‘magnus’ meaning huge and ‘cercus’, to describe its male cerci, large and longer than the subgenital plate. Chinese name: E14)! ai. dez.pensoft.net 350 Jun-Jie Gu et al.: Phylogeny of Sichuana with four new species A - = Figure 12. A-D. Body of Sichuana magnicerca sp. nov. A, B. Male holotype; C, D. Female paratype; A, C. Dorsal view; B, D. Lateral view; E. Male terminal abdomen with artificially unfurled cerci in dorsal view for showing inner tooth; F. Male terminal abdomen in dorsal view; G. Female terminal abdomen in dorsal view; H. Male terminal abdomen in lateral view; I. Male left tegmen in lateral view. Measurements (mm). Body (head to tip of abdomen): 30.78-33.023, 35.1-37.342:; pronotum: 8.16-9.046', 8.82-9.79; tegmen: 15.84-17.574', 8.14-8.929; mirror of right tegmen (from fore to hind): 4.39-4.646'; hind wing: 8.23-8.394', 5.28-5.7892: protibia: 8.12-9.14¢, 9.5-10.582:; profemur: 7.68-8.344', 8.04-8.989:; me- sotibia: 9.42-10.12¢, 10.52-11.7492; mesofemur: 8.44— 9.393, 9.1-10.189; metatibia: 22.24-24.43¢, 24.36- 27.762; metafemur: 23.02-24.88¢; 24.48-27.549; ovipositor: 21.48—24.39. Description. Male. Body size medium. Frons flat, slightly oblique. Frontal fastigium and clypeofrontal sul- cus black. Face light-colored. Occiput convex. Vertical fastigium broad, slightly wider than scape. Median ocel- dez.pensoft.net lus visible. Compound eyes broadly round and bulging outwards, surrounded by black coloration that extending backward to form a band. Filiform antennae inserted at inner sides of the compound eyes, scapus robust, much thicker than pedicel, flagellum tapering toward apex, cov- ered with short setae (Fig. 12A—D). Pronotum saddle-shaped, smooth, nearly equal to pro- femur in length. Disc of prozona with a broadly obtuse concavity in the middle of each side, anterior margin of pronotum slightly concave and posterior margin blunt, median carina faintly indicated in prozona, absent in metazona, lateral carina distinct in metazona, faintly in- dicated in prozona. Lateral lobe of pronotal length great- er than depth, with a light-colored stripe along the lateral Dtsch. Entomol. Z. 70 (2) 2023, 337-355 fReGM re eee: 7 Pa a CuPag au dle : 351 @! oe ScA frceM ‘gia uA, j ~ CuPa handle et Tee; - Pe " , A handis Figure 13. A-D. Tegmina of Sichuana magnicerca sp. nov. in dorsal view. A, C. Left tegmina; B, D. Right tegmina. margin, sometimes not obvious, humeral sinus obvious (Fig. 12A—D). Prosternum with a pair of cone-shaped spines (Fig. 14). Mesosternum with a pair of triangu- lar lobes, nearly equal in width to height. Metasternum with a pair of rounded triangular lobes, width distinctly greater than height (Fig. 14E). Thoracic auditory spira- cle elongated and elliptical, partially covered by lateral lobe of pronotum. Tegmen approximately equal to or slightly shorter than twice the length of pronotum, with clear longitudinal and cross veins. Tegmen folded downwards along M+CuA, the dorsal field flat, with a transverse lacuna in middle. Tegmen almost same width as disc of metazona from base to middle, and then gradually narrowing in dorsal view. Lateral field of tegmen distinctly broadened (Fig. 121). ScA weak, very close to anterior margin, ending at or before middle of anterior margin. ScP strong, with 5-6 branches. R usually forked to RA and RP after middle of tegmen, in a few examples very distally (for example, Fig. 13D). M+CuA forked to M and CuA before origin of handle. M usually very close to RP (Fig. 13A, C, D), or fused with RP then separateing immediately (Fig. 13B). Stridulatory file with about 33 teeth (Fig. 14G). Mirror on right tegmen pentagonal, length greater than width (Fig. 13B, D). Hind wing rudimentary. Legs. Prothoracic leg: genicular lobes armed with 1—2 internal spinules, unarmed externally. Dorsal surface of procoxa with a long spine; profemur with 3—5 internal black spinules ventrally; protibia with a slit-like auditory tympanum on both sides; protibia with 24 external spurs dorsally, with 5 spurs on each side ventrally; protibia with an external apical spur dorsally and a pair of apical spurs ventrally. Mesothoracic leg: genicular lobes armed with 1—2 spinules on each side; mesofemur with 2-3 external black spinules and 0-2 internal black spinules ventrally; mesotibia with 2—3 external spurs and 3—5 internal spurs dorsally, with 5 spurs on each side ventrally; mesotibia with an internal apical spur dorsally and a pair of api- cal spurs ventrally. Metathoracic leg: genicular lobes unarmed. Metafemur with sparse black spinules on each side ventrally; metatibia with a row of spines of different sizes on each side dorsally, with a row of sparse tiny spurs on each side ventrally, progressively denser toward the apex; metatibia with a pair of apical spurs dorsally, with two pairs of apical spurs ventrally, one pair of which dis- tinctly larger than the other. Apical area of the tenth abdominal tergite with a slight pileous lacuna covered with many tiny granular protru- sions. Posterior margin of tenth abdominal tergite with U-shaped notch in middle, sides of notch which form a pair of round blunt projections (Fig. 12E, F). Cercus large and long, extending beyond subgenital plate, conical and pileous, strongly incurved after middle, apex acute and slightly upturned. With a small, hook-like and incurved inner tooth at basal-most part of the cercus, tapering and curving from base to apex, invisible in lateral view (Fig. 12E, F, H). Subgenital plate length greater than width, with lateral carinae, middle part of posterior margin with a deep notch, width of notch varying among individu- als; stylus slender and longer than notch (Fig. 14A—C). Epiproct triangular. Titillator L-shaped, with only one row of denticles, gradually getting larger from base to apex on apical portion (Fig. 14F). Female. Similar to male, but body slightly larger. Tegmen shorter than pronotum, extending to the third ab- dominal tergum (Fig, 12B, D). Hindwing micropterous, dez.pensoft.net Jun-Jie Gu et al.: Phylogeny of Sichuana with four new species Figure 14. Sichuana magnicerca sp. nov. A-C. Male subgenital plate; D. Female subgenital plate; E. Thorax in ventral view; F. Titillator; G. Stridulatory file on the underside of the male left tegmen. longer than half of pronotum. Cercus conical and pileous. Tenth abdominal tergite depressed downward in middle, and with a V-shaped notch at middle of posterior margin, its sides forming a pair of round blunt projections (Fig. 12G). Subgenital plate nearly trapezoid, nearly equal in width to length, middle of posterior margin with a wide notch (Fig. 14D). Ovipositor slightly shorter than metafe- mur, slightly decurved distally (Fig. 12B, D). Remarks. S. magnicerca sp. nov. is similar to S. cryp- tospina Shen & Yin, 2020, but differs distinctly by: male cerci large and long, extending beyond subgenital plate, while those of S. cryptospina are relatively shorter and smaller, not extending beyond subgenital plate; the inner tooth is small and placed at the basal-most part of the cer- ci, while that of S. cryptospina is relatively larger and lon- ger, and is placed at the sub-basal area of the cerci (Fig. 12E, F, H); the apical portion of the titillator of S. magnic- erca sp. nov. has only | row of denticles that are aligned dez.pensoft.net vertically, while that of S. cryptospina has 1—2 rows that are aligned diagonally (Fig. 14F); and the female tenth abdominal tergite is depressed downward in the middle and has a V-shaped notch, while that of S. cryptospina has a U-shaped notch (Fig. 12G). S. magnicerca sp. nov. differs from S. feicui He, 2020, S. planicercata sp. nov., S. longilamina sp. nov. and S. curvicercata sp. nov. by its large and long male cerci, which extend beyond the subgenital plate. Furthermore, S. magnicerca sp. nov. differs from S. planicercata sp. nov. and S. curvicercata sp. nov. by: tenth abdominal tergite with a pair of round blunt projections on posterior mar- gin; in male tegmina M+CuA branching to M and CuA before origin of handle; and lateral field of male tegmina distinctly broadened. It differs from S. feicui by its male cerci strongly incurved after middle. It differs from S. /on- gilamina sp. nov. by male subgenital plate not extended beyond cerci, and male cerci incurved at an obtuse an- Dtsch. Entomol. Z. 70 (2) 2023, 337-355 gle. These four species also differ from S. magnicerca sp. nov. in shape of the inner teeth, denticles on the titillators, morphology of female tenth abdominal tergite, shape of stridulatory file, and the number of stridulatory teeth. Genetic distanceanalysis The mean of the sequence divergences for CO/ among species of Sichuana Shen & Yin, 2020 ranged from a low of 2.208% to a high of 15.688% (Table 3). The se- quence divergences for CO/ between most species are greater than 8%. While only S. planicercata sp. nov. and S. curvicercata sp. nov. show low sequence divergences between them (2.208%), this is still significantly great- er than the intraspecific mean of sequence divergence. Relative to COJ, the genetic distance analysis using 16S shows lower sequence divergence at all levels (Table 4). Molecular phylogenetic results The results of the ML and BI analyses are almost iden- tical (Fig. 15). S. feicui He, 2020 appears at the earliest position and is sister of all other Sichuana species. The rest consist of two clades. The clade containing S. mag- nicerca sp. nov., S. cryptospina Shen & Yin, 2020 and S. longilamina sp. nov. is sister of the clade containing S. planicercata sp. nov. and S. curvicercata sp. nov. S. longi- lamina sp. nov. is the sister group of the clade containing Table 3. Sequence divergences for CO/ among species of Sichuana. Species COI sequence divergences (%) ; § : : ; > 2 'S = 5 8 $ Ss be So < = Q S$ SJ & = (£ “4S (eo Ue -& S. planicercata 0.586 S. magnicerca 13.620 0.847 Slongilamina 13.150 10.738 = S feicui 15.391 15.688 14.407 — S. curvicercata 2.208 10.671 13.103 14.393 0.305 S. cryptospina 13.563 8.760 11.000 17.214 12.686 0.152 Table 4. Sequence divergences for 16S among species of Sichuana. Species 16S sequence divergences (%) = = & : QS 5 = = S 5 aS = S 5 a = ~ S 2 S 5 S 3 s = = S Ss ” S S. planicercata 0.127 S. magnicerca 3.989 0.000 S. longilamina 3.177 2.126 - S. feicui 5.828 4.945 3:19 — S. curvicercata 0.830 3.652 3.245 5.900 0.254 353 S. magnicerca sp. nov. and S. cryptospina. In the ML tree, samples of S. curvicercata sp. nov. resolved as the sister of the clade containing S. planicercata sp. nov. and other samples of S. curvicercata sp. nov. In contrast, these two Species are well resolved in the BI tree. Discussion Morphological variation within species Variation in wing shape and venation is documented in various groups of fossil orthopterans and their relatives (Zessin 1987; Béthoux 2008; Gu et al. 2010, 2011, 2014, 2021). However, this is rarely addressed in extant orthop- tera. The venation of Sichuana shows different degrees of intraspecific variation. For instance, the end of ScA, the dichotomous position of M, the dichotomous position of R and the fusion of some longitudinal veins are unstable among individuals, even in the left and right tegmina of an individual (Figs 3, 7, 10, 13), including structures asso- ciated with R. For instance, in S. planicercata sp. nov., R sometimes fuses distally with ScP and is separated imme- diately (Fig. 3A), R usually forks into RA and RP distally, but sometimes R is unbranched (Fig. 3B). In S. magnic- erca sp. nov. RP sometimes fuses with M and separated immediately (Fig. 13B). M also shows significant variation between individuals, mainly in the position of its forking to MA and MP. However, the bifurcation of R and M is usu- ally stable in fossil ensiferans (Gu et al. 2009, 2014, 2021; Wang et al. 2016). Therefore, more documentation on wing venation within species of extant orthopterans would help us better understand wing morphology and provide a reference for classification of extinct orthopterans. The male subgenital plate of Sichuana also shows different degrees of variation between individuals. The shape and width of the notch on its posterior margin vary between individuals, especially in S. planicercata sp. nov. (Figs 4, 8, 11, 14). Molecular analysis Genetic distance analysis shows that sequence diver- gences for CO/ between most species of Sichuana are greater than 8% (Table 3). While the sequence diver- gence between S. planicercata sp. nov. and S. curvicer- cata sp. nov. is significantly smaller, about 2.208%, it’s still significantly greater than the intraspecific mean of sequence divergence. Generally, the genetic distance within a species is much smaller than between species (Hebert et al. 2003b). Previous studies have shown that COI intraspecific divergences are rarely greater than 2% and most are less than 1% in insects (Avise 2000; Hebert et al. 2003a, b). Although there is a small amount of dif- ference between the results from the BI and ML methods, the molecular phylogenetic analysis resolved these sam- ples as six lineages with a high supporting rate. This is dez.pensoft.net 354 99 88 100 100 82.1 88.6 98.9 98.9 0.04 Jun-Jie Gu et al.: Phylogeny of Sichuana with four new species S. magnicerca 2 3 S. magnicerca 1 100 j S. magnicerca 4 = S. magnicerca 3 100 S. cryptospina 2 S. cryptospina 1 S. longilamina 81 S. planicercata 4 100 S. planicercata 2 87 S. planicercata 3 100 S. planicercata 1 55 S. curvicercata 2 S. curvicercata 1 S. feicui M. huangxinleii A. fengyangensis 33 S. magnicerca 2 79.2 S. magnicerca 1 98.1 S. magnicerca 4 S. magnicerca 3 99.2 : S. cryptospina 2 S. cryptospina 1 S. longilamina 74.7 S. planicercata 4 S. planicercata 2 S. planicercata 3 79.8 Lee S. planicercata 1 S. curvicercata 2 S. curvicercata 1 S. feicui M. huangxinileti A. fengyangensis Figure 15. The gene trees of Sichuana. A. BI phylogenetic tree; B. ML phylogenetic tree. consistent with results from morphological comparison. Therefore, assigning these specimens to four new species of Sichuana is justified. Conclusion Based on the morphological and molecular analysis above, we described four new species of Sichuana Shen & Yin, 2020, S. planicercata sp. nov., S. curvicercata sp. nov., S. Jongilamina sp. nov. and S. magnicerca sp. nov., and refined the diagnosis of the genus. This large sam- ple suggests that variation in wing venation and the male subgenital plate is common within species in this genus. dez.pensoft.net Acknowledgements We are grateful to the editor and the reviewers for pro- viding us with valuable suggestions and comments to improve this manuscript. We thank Wei Yuan for his help in the specimen collecting and data analysis. We thank Dr Bruce Archibald from the Beaty Biodiversi- ty Museum, Vancouver, Canada for improving the lan- guage. We thank Rong Huang for her help in the DNA extraction. We thank Huilai Zhang for his help in the map editing. This work was supported by the Nation- al Natural Science Foundation of China (grant numbers 41872020). We acknowledge the support of the Museum fur Naturkunde Berlin. Dtsch. Entomol. Z. 70 (2) 2023, 337-355 References Avise JC (2000) Phylogeography: the history and formation of species. Har- vard university press. Cambridge. https://dot.org/10.2307/j.ctv Inzfgj7 Béthoux O, Nel A (2002) Venation pattern and revision of Orthop- tera sensu nov. and sister groups. Phylogeny of Palaeozoic and Mesozoic Orthoptera sensu nov. Zootaxa 96(1): 1-88. https://doi. org/10.11646/zootaxa.96.1.1 Béthoux O (2008) Groundplan, nomenclature, homology, phylogeny, and the question of the insect wing venation pattern. Alavesia 2: 219-232. Chivers BD, Béthoux O, Sarria-S FA, Jonsson T, Mason AC, Mon- tealegre-Z F (2017) Functional morphology of tegmina-based strid- ulation in the relict species Cyphoderris monstrosa (Orthoptera: Ensifera: Prophalangopsidae). Journal of Experimental Biology 220(6): 1112-1121. https://doi.org/10.1242/jeb. 153106 Echeverry DF, Deason NA, Makuru V, Davidson J, Xiao H, Niedbalski J, Yu XY, Stevenson JC, Bugoro H, Aparaimo A, Reuben H, Cooper R, Burkot TR, Russell TL, Collins FH, Lobo NF (2017) Fast and robust single PCR for Plasmodium sporozoite detection in mosqui- toes using the cytochrome oxidase I gene. Malaria Journal 16: 1-8. https://doi.org/10.1186/s12936-017-1881-1 Esri R (2011) ArcGIS desktop: release 10. Environmental Systems Research Institute, CA. Gu J, Zhao YY, Ren D (2009) New fossil Prophalangopsidae (Orthop- tera, Hagloidea) from the Middle Jurassic of Inner Mongolia, China. Zootaxa 2004(1): 16-24. https://doi.org/10.11646/zootaxa.2004. 1.2 Gu JJ, Qiao GX, Ren D (2010) Revision and new taxa of fossil Propha- langopsidae (Orthoptera: Ensifera). Journal of Orthoptera Research 19(1): 41-56. https://doi.org/10.1665/034.019.0110 Gu JJ, Qiao GX, Ren D (2011) A exceptionally-preserved new species of Barchaboilus (Orthoptera: Prophalangopsidae) from the Middle Jurassic of Daohugou, China. Zootaxa 2909(1): 64-68. https://dot. org/10.11646/zootaxa.2909.1.7 Gu JJ, Yue YL, Wen WC, Zong LY, Ren D (2014) A review of research- es on Palaeozoic insects in China. Acta Entomologica Sinica 57(1): 123-132. https://doi.org/10.16380/,.kcxb.2014.01.006 Gu JJ, Xu Z, Huang R, Wang HJ, Yue YL, Ren D (2021) Systematic sig- nificance of wing morphology in extinct Prophalangopsidae (Insec- ta, Ensifera) revealed by geometric morphometrics and description of two new species. Journal of Systematic Palaeontology 19(22): 1587-1599. https://doi.org/10.1080/14772019.2022.2067491 He ZQ, Gong P, Hu TH, Yin ZX, Shen ZH, Wang BQ, Li K (2020) A new species of genus Sichuana from Sichuan, China (Orthoptera: Tettigoniidae: Tettigoniinae). Zootaxa 4877(1): 195-200. https://doi. org/10.11646/zootaxa.4877.1.10 Hebert PDN, Cywinska A, Ball SL, de Waard JR (2003a) Biological identifications through DNA barcodes. Proceedings of the Royal So- ciety of London. Series B, Biological Sciences 270(1512): 313-321. https://doi.org/10.1098/rspb.2002.2218 Hebert PDN, Ratnasingham S, De Waard JR (2003b) Barcoding animal life: Cytochrome c oxidase subunit 1 divergences among closely related species. Proceedings of the Royal Society of London, Se- ries B, Biological Sciences 270: S96—S99. https://doi.org/10.1098/ rsbl.2003.0025 Heller GK, Liu CX (2016) The East Palaearctic Genus Uvarovina (Orthoptera: Tettigoniidae): Taxonomic Remarks and Bioacous- tics. Journal of Orthoptera Research 25(2): 107-112. https://doi. org/10.1665/034.025.0201 355 Liu CX (2013) Review of Adanticus Scudder, 1894 (Orthoptera: Tettigo- niidae: Tettigoniinae) from China, with description of 27 new species. Zootaxa 3647(1): 1-42. https://doi.org/10.11646/zootaxa.3647.1.1 Liu CX (2015) New species from the genera Kansua and Anatlanti- cus (Orthoptera: Tettigoniidae) in China. Zootaxa 3925(2): e291. https://doi.org/10.11646/zootaxa.3925.2.10 Liu CX, Xu WJ, Zhang CT (2015) A new species of Mongolodectes (Orthoptera: Tettigoniidae) from Alashan plateau in China. Zootaxa 4052(2): 246-250. https://doi.org/10.11646/zootaxa.4052.2.11 Liu CX, Chen GY, Sun BX, Qiu XF, He ZQ (2018) A systematic study of the genus Ad/anticus Scudder, 1894 from Zhejiang, China (Orthoptera: Tettigoniidae: Tettigoniinae). Zootaxa 4399(2): e170. https://doi.org/10.11646/zootaxa.4399.2.2 Liu F, Chobanov DP, Chen LS, Liu CX (2019) Ceraeocercus Uvarov, a genus recorded in China for the first time (Orthoptera, Tettigoniidae; Tettigoniinae; Drymadusini). Zootaxa 4608(3): e586. https://doi. org/10.11646/zootaxa.4608.3.12 Nguyen LT, Schmidt HA, Von Haeseler A, Minh BQ (2015) IQ-TREE: a fast and effective stochastic algorithm for estimating maxi- mum-likelihood phylogenies. Molecular biology and evolution 32(1): 268-274. https://doi.org/10.1093/molbev/msu300 Pan CY, Hu J, Zhang X, Huang Y (2006) The DNA barcoding application of mtDNA COI gene in seven species of Catantopidae (Orthoptera). Entomotaxonomia 28: 103-110. https://dot.org/10.3969/j.1ssn. 1000- 7482.2006.02.004 Ramme W (1939) Beitrage zur Kenntnis der palaearktischen Orthopteren fauna (Tettig. u. Acrid.) II. Mitteilungen aus dem Zoologischen Muse- um in Berlin 24: 41-150. https://dot.org/10.1002/mmnz. 19320180308 Ronquist F, Teslenko M, Van Der Mark P, Ayres DL, Darling A, Héhna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP (2012) MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61(3): 539-542. https://doi.org/10.1093/sysbio/sys029 Shen ZH, Yin ZX, Lee M, Liu YJ, He ZQ, Wang ZF, Wang TX (2021) Pio- soproctus gen. nov., anew genus with two new species of Shield-back Katydid, with the first record of genus Eulithoxenus Bey-Bienko, 1951 from China (Orthoptera: Tettigoniidae: Tettigoniinae: Drymadusin1). Zootaxa 5067(4): 548-568. https://doi.org/10.11646/zootaxa.5067.4.4 Tamura K, Stecher G, Kumar S (2021) MEGA 11: Molecular Evolution- ary Genetics Analysis Version 11. Molecular Biology and Evolution. https://doi.org/10.1093/molbev/msab 120 Wang H, Zheng D, Hou X, Lei X, Zhang Q, Wang B, Fang Y, Jarzem- bowski EA, Zhang H (2016) The Early Cretaceous orthopteran Par- ahagla sibirica Sharov, 1968 (Prophalangopsidae) from the Jiuquan Basin of China and its palaeogeographic significance. Cretaceous Research 57: 40-45. https://doi.org/10.1016/j.cretres.2015.07.014 Xiong B, Kocher TD (1991) Comparison of mitochondrial DNA se- quences of seven morphospecies of black flies (Diptera: Simullti- dae). Genome 34(2): 306-311. https://dot.org/10.1139/g91-050 Yin ZX, He ZQ, Shen CZ, Shen ZH (2020) A new genus with a new species of Shield-back Katydid, with comments on the phylogeny and diagnosis of the genus Kansua Uvarov and the tribe Drymad- usini (Orthoptera: Tettigoniidae: Tettigoniinae) from China. Zootaxa 4786(3): 369-380. https://doi.org/10.11646/zootaxa.4786.3.3 Zessin W (1987) Variabilitat, Merkmalswandel und Phylogenie der Elcani- dae im Jungpalaozoikum und Mesozoikum und die Phylogenie der En- sifera (Orthopteroida, Ensifera). Deutsche Entomologische Zeitschrift 34(1-3): 1-76. https://doi.org/10.1002/mmnd. 19870340102 dez.pensoft.net