ore

JHR 72: I 1-26 (20 I 9) JOURNAL CF Apeenreviewed open-access journal
mise hes (f-) Hymenoptera

http://jhr.pensoft.net The Insertional Society of Hymenoptersts. RESEARCH

Hybrizon Fallén (Hymenoptera, Ichneumonidae,
Hybrizontinae) in China

Jing-Xian Liu', Cornelis van Achterberg”, Bo-Ying Zheng’, Qi-Meng Yang?

| Department of Entomology, South China Agricultural University, Guangzhou 51064, China 2 State Key
Laboratory of Rice Biology and Ministry of Agriculture, Key Lab of Agricultural Entomology, Institute of Insect
Sciences, Zhejiang University, Hangzhou 310058, China 3 Forestry Protection Station of Shanghe County,
Shandong Prov. Jinan, China

Corresponding author: /ing-Xian Liu (jingxianliu@foxmail.com)

Academic editor: Gavin Broad | Received 22 August 2019 | Accepted 3 October 2019 | Published 31 October 2019
Attp://zoobank. org/CBAIDB98-7209-4B32-B1D0-30BA71047699

Citation: Liu J-X, van Achterberg C, Zheng B-Y, Yang Q-M (2019) Hybrizon Fallén (Hymenoptera, Ichneumonidae,
Hybrizontinae) in China. Journal of Hymenoptera Research 72: 11-26. https://doi.org/10.3897/jhr.72.39333

Abstract

The species of the genus Hybrizon Fallén (Hymenoptera: Ichneumonidae: Hybrizontinae) from China are
reviewed, with special reference to Shandong (North China). Two new species (Hybrizon hei sp. nov. and
H. xui sp. nov.) are described and illustrated. A key to the East Palaearctic species of Hybrizon is included.

Keywords

Ichneumonidae; Hybrizon; Palaearctic; China; Shandong; endoparasitoids; ant larvae; key

Introduction

Hybrizon Fallén, 1813, belongs to the small subfamily Hybrizontinae Blanchard,
1845 (= Paxylommatinae Foerster, 1863, Hybrizoninae of some authors; Wharton
and van Achterberg 2000) and contains endoparasitoids of ant larvae carried by work-
ers outside their nest (GOmez Duran and van Achterberg 2011). Most likely the sub-
family belongs to the family Ichneumonidae (Rasnitsyn 1980; Yu and Horstmann
1997), but was often associated with Braconidae (van Achterberg 1976) or considered
to be a separate family (He 1981, Tobias 1988). The structure of the connection of

Copyright Jing-Xian Liu et al. This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY
4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

12 Jing-Xian Liu et al. / Journal of Hymenoptera Research 72: 11-26 (2019)

the second and third metasomal tergites and the venation of the hind wing, both in-
dicate a closer relationship with the family Ichneumonidae (Sharkey and Wahl 1987;
Wahl and Sharkey 1988) than with the Braconidae. According to the analysis of 28S
ribosomal RNA Hybrizontinae are at a basal position of the Ichneumonidae-lineage
(Belshaw et al. 1998; Quicke et al. 2000; Belshaw and Quicke 2002), but Gillespie et
al. (2005) documented the unusual structure of 28S in Hybrizon, which makes proper
alignment difficult. Quicke et al. (2009) and Broad et al. (2018) placed Hybrizon
as derived subfamily within the ophioniformes-group of the Ichneumonidae. In the
most recent overview (Bennett et al. 2019) Hybrizontinae are also included in the
ophioniformes and grouped with part of the Ctenopelmatinae if all morphological
and molecular data are combined. When only the molecular data are used Hybri-
zontinae cluster with Tersilochinae, Cremastinae, part of Mesochorinae and Sisyros-
tolinae. Hybrizontinae can be most easily separated by their aberrant venation of the
fore wing (Figs 10, 17, 24), the antenna of both sexes with only 13 segments and the
enlarged hind basitarsus. Only Neorhacodinae show a similar fusion of veins SR and
M (= vein 3-SR+M) of the fore wing (as a result no vein r-m is present) and have
also antenna with 13 segments, but Neorhacodinae lack the enlarged hind basitarsus
of Hybrizontinae. Neorhacodinae are not considered to be closely related, but are
grouped also in the ophioniformes (Bennett et al. 2019). Hybrizon is known from the
Holarctic region and the NE part of the Oriental region (van Achterberg et al. 2013).
Only three other extant genera are known, of which two are very similar: Eurypterna
Foerster, 1863 (= Ogkosoma Haupt, 1913) and Ghilaromma Tobias, 1988 (Tobias
1988; van Achterberg 1999). The third extant genus is described very recently from
Japan (Neohybrizon Hisasue & Konishi, 2019) with only the type species (NV. mutus
Hisasue & Konishi, 2019) known. Neohybrizon differs from the other extant genera
by the extremely reduced mouth parts, the longer mesoscutum, the absence of the
prepectal carina, the depressed medio-posterior area of the mesoscutum, the larger
parastigma, the slenderer pterostigma, the straight vein 1-SR+1-M of the fore wing,
and the longer hind femur (more than 5.5 x as long as the hind trochanter, about 4
times in Hybrizon) (mainly after Hisasue and Konishi 2019).

Material and methods

The collecting site is the Forestry Protection Station in Jinan (NE China, Shandong
Prov., Shanghe County) and the collecting was done with Malaise traps. Images were
acquired by using a KEYENCE VHX-5000 Digital Microscope imaging system and
processed with Photoshop CC software.

For references to East Palaearctic genera and species of Hybrizontinae, see Yu et
al. (2016) and for morphological terminology, see van Achterberg (1988). The speci-
mens are deposited in the Institute of Insect Sciences, Zhejiang University, Hangzhou
(ZJUH), Department of Life Sciences, Northwest University, Xi'an (NWUX) and
Naturalis Biodiversity Center, Leiden (RMNH). An asterisk indicates new to the fauna.

Hybrizon in China 13

DNA extraction

Genomic DNA was extracted from female adult specimens by using DNeasy Blood and
Tissue Kit (Qiagen, Hilden, Germany) and following a non-destructive DNA extrac-
tion protocol as described in Taekul et al. (2014). Voucher specimens after extraction
were washed by 100% alcohol and restored in Zhejiang University (Hangzhou, China).

PCR amplification and COI, 28SrRNA sequencing

The barcode region of the mitochondrial cytochrome oxidase subunit I (COJ) was
amplified using the LCO1490/HCO2198 primer pair: (F) (LCO1490) GGT-
CAACAAATCATAA AGATATTGG; (R) (HCO2198) TAAACTTCAGGTGAC-
CAAAAAATCA (Folmer et al. 1994). The nuclear 285 rRNA D1-2 (28S) was
amplified using the primer part: (F) (3665) AGAGAGAGTTCAAGAGTACGTG;
(R) (4068) TTGGTCCGTGTTTCAAGACGGG (Belshaw et al. 1998). PCRs
were carried out using Tks Gflex DNA Polymerase (Takara) and conducted in a
T100 Thermal Cycler (Bio-rad). PCR protocols followed the studied listed above
for each molecule. Amplifications were sequenced by Sanger method on an Applied
Biosystems (ABI) 3730XL by Sangon Biotech (Shanghai, China). All the ampli-
fied sequences were uploaded into GenBank (accession numbers in descriptions).
The COJ sequence of H. buccatus (KU753286) and 28S sequences of H. bucca-
tus (KU753494) and H. ghilarovi (EU378579) were downloaded from GenBank.
Sequences of Lathrolestes nigricollis (Thomson, 1883) (GQ325436.1) and Perilissus
rufoniger (Gravenhorst, 1820) (KR880228) were used as out-groups to root the COJ
trees. Sequences of Perilissus rufoniger (Gravenhorst, 1820) (EU378529) was used as
out-group to root the 28S rRNA tree.

Data analysis

The preliminary alignment was carried out by using MAFFT v.7.388 by the G-INS-I
strategy for CO/ and Q-INS-I strategy for 28S (Katoh and Standley 2013). Alignments
were checked and corrected manually, and the final alignments of CO/ and 28S were
635bp and 697bp, respectively. The alignments were then analyzed using RAxML as

implemented in Geneious 11.0.3.

Results

The results of the RAxML analysis are presented in Figures 30, 31. The ML phyloge-
netic tree both of CO/ and 28S rRNA revealed that all species from Shandong province

based on morphological characters were also supported by molecular differences. The

14 Jing-Xian Liu et al. / Journal of Hymenoptera Research 72: 11-26 (2019)

pairwise percentage identity of CO/ sequences between the three in-group species was
81.072% to 85.93%, with out-group Lathrolestes nigricollis and Perilissus rufoniger, was
76.717% to 78.559%, and 64.992% to 67.504%, respectively.

Genus Hybrizon Fallén, 1813
Figs 1-29

Hybrizon Fallén, 1813: 19; Bennett et al. 2019: 68; Hisasue and Konishi 2019: 241;
for earlier references see van Achterberg et al. (2013) and Yu et al. (2016).

Syn.: Paxylomma de Brébisson, 1817; Paxyloma Stephens, 1835; Paxylomme Wesmael,
1835; Paxyllomma Curtis, 1837; Paxylloma Blanchard, 1840; Pachylomma Ratze-
burg, 1848; Plancus Curtis, 1833; Eupachylomma Ashmead, 1894.

Key to East Palaearctic species of the genus Hybrizon Fallén

1 In lateral view length of hind basitarsus 4.0—5.0 times its maximum width
(Figs 2, 3, 11); mesoscutum with pair of anteriorly broad bands of distinct
punctures (Fig. 14), rarely punctures largely absent or obsolescent; vein 1-M
of fore wing paler than vein 2-CU1 of fore wing (Fig. 10); basal cell of fore
wing largely glabrous, with about 15 setae (Figs 1, 10), rarely more; scutellum
(except sometimes laterally) dark brown as mesoscutum medio-posteriorly
(Fig. 14); [length of fore wing 2-3 mm; propodeum largely smooth or granu-
late, except for medial carinae]; Mongolia, Russia, Japan (Kyushu, Shikoku),
South Korea, China (Jilin; ?Heilongjiang; *Shaanxi; *Shandong)..................
Saleh Sa ee le Mn, ce Ato ND, ts H.. buccatus (de Brébisson, 1825)

— In lateral view length of hind basitarsus 5.4—7.0 times its maximum width
(Figs 5, 18, 25); mesoscutum usually smooth, at most with narrow bands of
punctures or notaulic area granulate (Figs 21, 28); vein 1-M of fore wing as
dark as vein 2-CU1 of fore wing or nearly so (Figs 17, 24); basal cell of fore
wing variable, if largely glabrous, then scutellum (except medio-anteriorly)
ivory and contrasting with mesoscutum medio-posteriorly (Figs 26, 28).....2

2: Basal cell of fore wing largely glabrous or sparsely setose, with 10—24 setae
(Fig. 24); disco-submarginal cell of fore wing about as high as subdiscal cell
(Fig. 24); ivory scutellum (except medio-anteriorly) distinctly contrasting with
dark brown mesoscutum medio-posteriorly (Figs 26, 28), rarely both dark
brown; anteriorly notaulic area of mesoscutum ivory or brownish (Figs 26,
28), rarely dark brown; scutellum strongly shiny and smooth (Fig. 28); maxi-
mum width of face 1.3—1.4 times its minimum width (Fig. 27); length of fore
wing 2.6-3.7 mm; China (Shandong), South Korea .............. H. xui sp. nov.

— Basal cell of fore wing (except basally) more or less evenly setose (Figs 4,
6, 17); disco-submarginal cell of fore wing 1.4-1.9 times as high as subdis-

Hybrizon in China 15

cal cell (Figs 4, 6, 17); scutellum and mesoscutum medio-posteriorly usu-
ally similarly dark brown, but sometimes intermediate (Fig. 21); anteriorly
notaulic area often dark brown; scutellum moderately shiny and more or
less granulate (Fig. 21); maximum width of face 1.2—1.4 times its minimum
width thio 2O)olenoth ot ore wine 2 13 MIT ce. sexbs ncosveneeabyeneoabvenecnene 3
3 Eyes distinctly setose; vein 1-M of fore wing straight anteriorly or nearly so
(Fig. 6); ovipositor long and setose part of ovipositor sheath 0.5—0.7 times
as long as second metasomal tergite (Fig. 7); scutellum and notaulic area of
mesoscutum distinctly granulate; vein r of fore wing issued rather far from
base of pterostigma (Fig. 6); pedicellus about as wide as scapus; [ventrally
pedicellus yellowish or brown; ventral half of metapleuron coarsely rugose to
densely rugulose]; Russia (Far East); Japan (Hokkaido), China (Hunan, Jilin,
“Shaan. South-Korean ens 200 ace eee H. ghilarovi Tobias, 1988
- Eyes glabrous (Fig. 21); vein 1-M of fore wing weakly curved anterior-
ly (Figs 4, 17), rarely nearly straight; ovipositor shorter and setose part of
ovipositor sheath 0.2—0.4 times as long as second tergite (Figs 15, 16, 29);
scutellum and mesoscutum smooth or superficially granulate (Fig. 21); vein r
of fore wing issued close to base of pterostigma (Figs 4, 17); pedicellus slightly
WAGE THAN, SCAPUS pace teguthe ebaiteatocwotniccatiton conven tonnve Ronnie Salven sdate Ry cdaite aed eee 4
4 Face yellow; vein r of fore wing nearly vertical (Fig. 4); maximum width of
face 1.11.2 times its minimum width; ventral half of face less shiny and
more or less granulate; pedicellus brown ventrally, darker than yellowish
scapus; Russia (Far East); China (Hunan)...... H. flavofacialis Tobias, 1988
- Face at least partly dark brown or brown (Fig. 20); vein r of fore wing dis-
tinctly oblique (Fig. 17); maximum width of face 1.3—1.4 times its minimum
width (Fig. 20); ventral half of face distinctly shiny and largely smooth; pedi-
cellus and scapus ventrally similarly yellowish or pedicellus somewhat darker
(Figs 16, 19, 21); [ventral half of metapleuron and of mesopleuron granu-
late|s¢Gchina(Shandone): «nu. ccn chen asc idler assscticineauenda: H. hei sp. nov.

Species occurring in China

Hybrizon buccatus (de Brébisson, 1825)
Figs 1-3, 9-15

Material. 1 2 (ZJUH), “NE China: Shandong, Shanghe County, Jinan, Xushang,
Dong Balizhuang, 36°16'4"N, 117°9'10"E, Malaise trap, 24—30.ix.2018, Jia-He Yan
& Qi-Meng Yang”; 2 29 (NWUX), “NW China: Shaanxi, Xunyangba, Ningshaan,
1481 m, Y[ellow] & G[reen] [Malaise] trap, 33°54'N, 108°55'E, 1.vii-17.viii.2016,
Tan JL & Tan QQ, NWUX”. Reported from North China by He (1981: Heilongji-
ang, Jilin) and by Konishi et al. (2012: Jilin). The figured specimen in He (1981)
probably belongs to H. xui sp. nov. The listed material could not be retrieved, but

16 Jing-Xian Liu et al. / Journal of Hymenoptera Research 72: 11-26 (2019)

\ \ an er 1}
Vwanatyy VA
‘\ Vy \

Figures 1-8. |-3 Hybrizon buccatus (de Brébisson) 2, Bulgaria, Brodilovo, but 3 of 9 from Nether-
lands, Nunspeet 4,5 H. flavofacialis Tobias, female, China, Hunan, Yuanjiang 6, 7 H. ghilarovi Tobias:
6 of 2, China, Hunan, Yuanjiang and 7 of 9, Bulgaria, Brodilovo 8 H. juncoi (Ceballos), 2, Spain, Es-
tepona I, 4, 6 basal half of fore wing 2, 3,5 hind basitarsus lateral 7 ovipositor and sheath lateral 8 palpi
anterior. From van Achterberg (1999) and van Achterberg et al. (2013).

Hybrizon in China 17

Figures 9-15. Hybrizon buccatus (de Brébisson), 9, China, Shandong 9 habitus, lateral aspect 10 wings
II hind tarsus, lateral aspect 12 head and mesosoma, lateral aspect 13 head, anterior aspect 14 head and

mesosoma, dorsal aspect 15 ovipositor and ovipositor sheath, lateral aspect.

the figure shows a slender hind basitarsus (about 6 times as long as wide) and vein r
of fore wing connected somewhat distally from base of pterostigma, what does not
fit with H. buccatus.

18 Jing-Xian Liu et al. / Journal of Hymenoptera Research 72: 11-26 (2019)

Differentiating diagnosis. Easily to separate from other Chinese species because of
the largely glabrous basal cell of fore wing, combined with dark brown scutellum, less
slender hind basitarsus and lesser body size (length of fore wing not exceeding 3 mm).

Hybrizon flavofacialis Tobias, 1988
Figs 4, 5

Material. Series from S. China (Hunan) listed by van Achterberg et al. (2013).

Differentiating diagnosis. Differs from other Chinese species by the long and
robust ovipositor, the granulate mesoscutum and scutellum, and the nearly vertical
vein r of fore wing.

Hybrizon ghilarovi Tobias, 1988
Figs 6, 7

Material. 1 2° (NWUX), “NW China: Shaanxi, Panda valley, Foping, black Mal|aise]
trap, 1411 m, 33°67'N, 107°97'E, 29.v.-19.vi.2016, Tan JL & C. v. A[chterberg],
NWUxX’”. Series from S. China (Hunan) listed by van Achterberg et al. (2013). Koni-
shi et al. (2012) reported this species from NE China (Jilin).

Differentiating diagnosis. Differs from other Chinese species by the distinctly se-
tose eyes, vein 1-M of fore wing straight anteriorly or nearly so (Fig. 8) and long setose
part of ovipositor sheath (0.6—0.7 times as long as second metasomal tergite).

Hybrizon hei van Achterberg & Liu, sp. nov.
http://zoobank.org/AF9727B5-5B3F-47 1F-9026-539BBFC0B78 1
Figs 16-22

Type material. Holotype, 2 (ZJUH), “NE China: Shandong, Shanghe County, Jinan,
Xushang, Dong Balizhuang, 36°16'4"N, 117°9'10"E, Malaise trap, 24—30.ix.2018,
Jia-He Yan & Qi-Meng Yang”, “20190119” (the molecular sequences originate from
this specimen). Paratypes (ZJUH, RMNH): 10 9, same data as holotype.

Differentiating diagnosis. The West Palaearctic H. pilialatus Tobias, 1988, is very
similar to the new species, but H. pilialatus has vein r of fore wing distinctly removed
from base of pterostigma and less oblique (Fig. 15 in van Achterberg 1999; vein r is-
sued virtually at base of pterostigma and distinctly oblique in H. hei), disco-submar-
ginal cell of fore wing 1.1 times higher than subdiscal cell (1.5-1.9 times in H. hei)
and vein 1-R1 (= metacarp) of fore wing about 0.4 times length of pterostigma (about
0.6 times in H. hei). According to the molecular analyses it is distinctly separated from
H. xui and H. buccatus (Figs 30, 31); unfortunately, molecular data of its most closely
relative (H. pilialatus) are yet unknown.

Molecular data. MN 168094 (28S) and MN125615 (COJ).

Hybrizon in China 19

Figures 16-22. Hybrizon hei sp. nov., 2, paratype 16 habitus, lateral aspect 17 wings 18 hind tarsus,
lateral aspect 19 head and mesosoma, lateral aspect 20 head, anterior aspect 21 head and mesosoma,

dorsal aspect 22 ovipositor and ovipositor sheath, lateral aspect.

Description. Holotype, 9, length of body 3.6 mm, of fore wing 2.6 mm.

Head. Antenna with 13 segments and 0.9 times as long as fore wing, length of
third segment 1.3 times fourth segment, length of third, fourth and penultimate seg-
ments 6.5, 5.0 and 3.0 times their width, respectively; pedicellus slightly longer and
wider than scapus; apical segment of maxillary palp rather elongate (compared to
width of penultimate segment; Fig. 19); face rugulose-granulate medio-dorsally and
remainder largely smooth (Fig. 20); maximum width of face 1.4 times its minimum
width (Fig. 20); frons granulate and rather shiny, near antennal sockets depressed and

20 Jing-Xian Liu et al. / Journal of Hymenoptera Research 72: 11-26 (2019)

rugulose; length of eye 3.8 times temple in dorsal view; temples directly narrowed be-
hind eyes; vertex shiny and very superficially granulate; OOL:diameter of ocellus:POL
= 3:3:6; length of malar space 2.5 times basal width of mandible, concave, anteriorly
smooth and posteriorly granulate.

Mesosoma. Length of mesosoma 1.1 times its height; mesoscutum strongly
shiny, smooth (except for some superficial punctulation) and without notauli (Fig.
21); scutellum convex and moderately shiny, superficially granulate (Fig. 21); ven-
tral half of mesopleuron rather matt and granulate; mesosternal sulcus narrow and
smooth; metapleuron shiny and granulate; metanotum slightly and obtusely pro-
truding dorsally; propodeum granulate, but medially and posteriorly areolate with
interspaces largely smooth.

Wings. Fore wing: marginal cell comparatively slender (Fig. 17); basal cell of fore
wing largely and evenly setose (Fig. 17); vein r issued at base of pterostigma and dis-
tinctly oblique (Fig. 17); vein 1-M moderately curved and medium-sized, with disco-
submarginal cell 1.5 times higher than subdiscal cell.

Legs. Hind coxa granulate; in lateral view length of femur, tibia and basitarsus of
hind leg 8.3, 7.6 and 5.6 times their width, respectively; spurs of hind tibia 0.3 and
0.4 times hind basitarsus.

Metasoma. Length of first tergite 3.1 times its apical width, shiny, smooth ex-
cept some aciculae, laterally rugose (Fig. 19), subapically parallel-sided and its spiracles
slightly protruding; basal half of second tergite with some weak striae; remainder of
metasoma smooth and shiny; hypopygium with bristly setae; second tergite with sharp
lateral crease; length of setose part of ovipositor sheath 0.08 times fore wing and 0.26
times second metasomal tergite (Fig. 22); ovipositor needle-shaped.

Colour. Dark brown or brownish black; mouthparts (including mandible) and
clypeus largely white; scapus, pedicellus ventrally, tegulae, legs and anterior half of
fourth tergite yellowish brown; scutellum (except medially), pronotum, mesosternum,
mesopleuron (except dorsally) and metasoma (except first tergite) mainly brown; re-
mainder of antenna largely dark brown; veins and pterostigma largely brown; vein 1-M
of fore wing paler than vein 2-CU1 of fore wing; wing membrane subhyaline.

Variation. Length of body (2.3—)3.4—4.1 mm, of fore wing (2.1—)2.6-2.9 mm;
maximum width of face 1.3—1.4 times its minimum width; in lateral view length of
hind basitarsus 5.4—5.8(—6.3) times its maximum width; disco-submarginal cell of fore
wing 1.4—1.7(—1.9) times higher than subdiscal cell; scutellum sometimes rather flat
and not reaching level of mesoscutum, but in most specimens convex and protruding
above level of mesoscutum, dark brown to largely pale yellowish; face dark brown or
partly pale brown, frequently with ivory stripe medially; mesoscutum dark brown or
brown antero-laterally.

Distribution. China (Shandong).

Etymology. Named after Prof. Dr Jun-Hua He (Zhejiang University, Hangzhou)
on the occasion of his 90" birthday for his numerous contributions to the systematics
of Chinese Hymenoptera for more than 45 years.

Hybrizon in China 21

Hybrizon xui van Achterberg & Liu, sp. nov.
http://zoobank.org/4AA0A64B-BA65-43EA-9249-7ANEF3 EEO5AA
Figs 23-29

Hybrizon juncoi: Konishi et al. 2012: 21, 22.

Type material. Holotype, 2 (ZJUH), “NE China: Shandong, Shanghe County, Jinan,
Xushang, Dong Balizhuang, 36°16'4"N, 117°9'10"E, Malaise trap, 24—30.ix.2018,
Jia-He Yan & Qi-Meng Yang”, Paratypes (ZJUH, RMNH): 40 9, same data as holo-
type, of which 1 2 (ZJUH) additionally labelled “201901120”, because the molecular
sequences originate from this specimen.

Differentiating diagnosis. The new species is similar to the SW Palaearctic H.
juncoi (Ceballos, 1957), because of the largely glabrous basal cell of the fore wing, vein
1-M of fore wing as dark as vein 2-CU1 of fore wing, ivory scutellum (except medio-an-
teriorly), larger body size and anterior notaulic area of mesoscutum more or less ivory or
brownish. Konishi et al. (2012) included Korean specimens of this species under 1. jun-
coi, but H. juncoi has the hind basitarsus about 4.5 times longer than wide (both sexes;
5.6—6.8 times in H. xwi), vein r of fore wing issued comparatively far removed from base
of pterostigma (distance to base of pterostigma about equal to length of vein r; much
less so in H. xui), propodeum distinctly rugose-granulate (granulate and partly smooth
in H. xui), vein 1-M comparatively short (fig. 41 in van Achterberg 1999), resulting in
a transverse disco-submarginal cell lower than subdiscal cell (vein 1-M medium-sized,
resulting in a disco-submarginal cell as high as subdiscal cell in H. xuz) and penultimate
segment of maxillary palp enlarged (Fig. 8; small in H. xuz). According to the molecular
analyses it is distinctly separated from H. fei and H. buccatus (Figs 30, 31); unfortu-
nately, molecular data of its most closely relative (H. juncoi) are yet unknown.

Molecular data. MN168195 (28S) and MN260327 (COZ).

Description. Holotype, 9, length of body 4.2 mm, of fore wing 3.1 mm.

Head. Antenna with 13 segments and 0.9 times as long as fore wing, length of
third segment 1.4 times fourth segment, length of third, fourth and penultimate seg-
ments 5.3, 3.8 and 3.3 times their width, respectively; pedicellus slightly shorter than
and as wide as scapus; penultimate segment of maxillary palp small compared to api-
cal segment (Fig. 26); face rugulose-granulate medio-dorsally and remainder largely
smooth; maximum width of face 1.4 times its minimum width (Fig. 27); frons smooth
and shiny but near antennal sockets depressed and rugulose; length of eye 6.8 times
temple in dorsal view; temples directly narrowed behind eyes; vertex shiny and super-
ficially granulate; OOL:diameter of ocellus:POL = 3:5:7; length of malar space 1.3
times basal width of mandible, concave and largely smooth, posteriorly granulate.

Mesosoma. Length of mesosoma 1.2 times its height; mesoscutum strongly shiny
and smooth, only anteriorly with few punctures and notauli absent (Fig. 28); scutel-
lum strongly convex (protruding up to dorsal level of mesoscutum or above) and shiny,
smooth (Figs 26, 28); mesopleuron shiny and largely smooth; mesosternal sulcus nar-

22 Jing-Xian Liu et al. / Journal of Hymenoptera Research 72: 11-26 (2019)

Figures 23-29. Hybrizon xui sp. nov., 9, paratype 23 habitus, lateral aspect 24 wings 25 hind tarsus,

lateral aspect 26 head and mesosoma lateral aspect 27 head, anterior aspect 28 head and mesosoma,

dorsal aspect 29 ovipositor and ovipositor sheath, lateral aspect.

row and smooth; metapleuron shiny and granulate; metanotum obtusely protruding
dorsally; propodeum granulate, but medially and posteriorly with some rugae or cari-
nae and interspaces largely smooth.

Wings. Fore wing: marginal cell comparatively wide (Fig. 24); basal cell of fore
wing largely glabrous, with 18 setae (Fig. 24); vein r nearly vertical and issued compar-
atively close to base of pterostigma (Fig. 24); vein 1-R1 0.6 times length of pterostig-

Hybrizon in China 23

Perilissus rufoniger
(EU378529)

Hybrizon hei sp. nov.
(MN168094)

fybrizon ghilarovi
(EU378579)

Hybrizon xui sp. nov.
(MN168095)

30

0.03
Hybrizon buccatus
(KU753494)

Perilissus rufoniger
(KR880228)

Lathrolestes nigricollis
(GQ325436.1)

FHybrizon buccatus
(KU753286)

Hybrizon xui sp. nov.
(MN260327)

31

0.07 Hybrizon hei sp. nov.

(MN125615)

Figures 30, 31. RAxML result analysis of 28S and CO/ sequences. Numbers in parentheses are Gen-

Bank numbers.

ma; vein 1-M moderately curved and medium-sized, resulting in a disco-submarginal
cell as high as subdiscal cell.

Legs. Hind coxa finely granulate; in lateral view length of femur, tibia and basitar-
sus of hind leg 6.9, 6.8 and 5.6 times their width, respectively; spurs of hind tibia 0.35
and 0.40 times hind basitarsus.

Metasoma. Length of first tergite 3.4 times its apical width, shiny, smooth (also
laterally), medially with shallow elongate depression, subapically widened and its spira-
cles slightly protruding; second tergite with spaced striae basally and some superficial
micro-sculpture medially; remainder of metasoma smooth and shiny; hypopygium

24 Jing-Xian Liu et al. / Journal of Hymenoptera Research 72: 11-26 (2019)

with long bristly setae (Fig. 29); second tergite with sharp lateral crease; length of setose
part of ovipositor sheath 0.08 times fore wing and 0.26 times second metasomal tergite.

Colour. Dark brown; mouthparts (including mandible) and tegulae white; scapus,
and scutellum (except medio-anteriorly) ivory; scutellum distinctly contrasting with
dark brown mesoscutum medio-posteriorly (Fig. 28); mesoscutum antero-laterally,
pronotum, mesosternum, mesopleuron dorsally and ventrally, anterior half of fourth
tergite and legs yellowish brown; pedicellus entirely brown and distinctly contrasting
with pale scapus (Figs 26, 27), remainder of antenna largely dark brown; veins and
pterostigma largely dark brown; vein 1-M of fore wing as dark as vein 2-CU1 of fore
wing or nearly so; wing membrane subhyaline.

Variation. Length of body (3.2—)3.6—-4.5 mm, of fore wing 2.6-3.7 mm; maxi-
mum width of face 1.3—1.4 times its minimum width; basal cell of fore wing with 10—
24 setae; anteriorly notaulic area of mesoscutum ivory or brownish yellow, rarely dark
brown; in lateral view length of hind basitarsus 5.4—6.6 times its maximum width;
pedicellus entirely brown or dark brown, rarely pale yellowish ventrally; apical half of
fourth tergite dark brown to brownish yellow; hind leg brownish yellow to brown. One
paratype has a transverse groove subbasally on the second tergite.

Distribution. China (Shandong).

Etymology. Named in commemoration of the much too early deceased hymenop-
terist Prof. Dr Zai-Fu Xu (South China Agricultural University, Guangzhou; ix.1965
— vi.2017) for his great contributions to our knowledge of the Chinese Hymenoptera.

Discussion

There are five species (including the two new species in present study) recognized from
the Chinese fauna (van Achterberg et al. 2013, Konishi et al. 2012). The three species
of Hybrizon from Shandong province are separated by the morphological characters
and supported by the genetic distance between COI sequences as well. Unfortunately,
molecular data of most closely relative species (1. pilialatus Tobias, 1988 and H. juncoi
(Ceballos, 1957) are not yet known. But all these species can be distinguished based on
the morphological characters alone. Konishi et al. (2012) included the Korean speci-
mens under H. juncoi (Ceballos, 1957), but based on the ratio of length to width of
hind basitarsus, we consider it should be a misidentification and include it under H.
xui sp. nov. Based on the pairwise percentage identity of CO/ sequences of the three
species from China are also significantly different, the genetic distance between species
from the same locality is also very high.

The specimens of Hybrizon hei sp. n and H. xui sp. nov. collected in the Malaise
trap in Shandong province all are female, there are 11 individuals of H. hei sp. nov.
and 41 individuals of H. xui sp. nov. Only a single female specimen of H. buccatus
was found in the same locality. Biologically, species of Hybrizontinae are known to
be associated with ants (Donisthorpe and Wilkinson 1930, Gémez Duran and van
Achterberg 2011, Hisasue and Konishi 2019), it is highly likely that the new species
from Shandong also emerged from some ant nest near the Malaise trap.

Hybrizon in China 2)

Acknowledgements

We are deeply grateful to Mr. Jia-He Yan (Forestry Protection Station of Shanghe
County, Shandong Province) for his help to collect the specimens, Prof. Xue-Xin
Chen (Zhejiang University) for his encouragement during the research, thanks to Prof.
Ming-Yi Tian (South China Agricultural University) for access to the digital camera
and Dr. Hua-Yan Chen (Sun Yat-Sen University) for his kind help in molecular analy-
sis. [his project was supported by the National Basic Research Program of China (No.
2013CB127600) for JXL.

References

Belshaw R, Fitton M, Herniou E, Gimeno C, Quicke DLJ (1998) A phylogenetic reconstruc-
tion of the Ichneumonoidea (Hymenoptera) based on the D2 variable region of 28S ri-
bosomal RNA. Systematic Entomology 23: 109-123. https://doi.org/10.1046/j.1365-
3113.1998.00046.x

Belshaw R, Quicke DLJ (2002) Robustness of ancestral state estimates: evolution of life his-
tory strategy in ichneumonoid parasitoids. Systematic Biology 51(3): 450-477. https://
doi.org/10.1080/10635 150290069896

Bennett AMR, Cardinal S, Gauld ID, Wahl DB (2019) Phylogeny of the subfamilies of Ich-
neumonidae (Hymenoptera). Journal of Hymenoptera Research 71: 1-156. https://doi.
org/10.3897/jhr.7 1.32375

Broad GR, Shaw MR, Fitton MG (2018) Ichneumonid wasps (Hymenoptera: Ichneumoni-
dae): their classification and biology. Handbooks for the Identification of British Insects
7(12): 1-418.

Donisthorpe HJK, Wilkinson DS (1930) Notes on the genus Paxylomma (Hymenoptera, Braco-
nidae) with the description of a new species taken in Britain. Transactions of the Royal Ento-
mological Society London 78: 87-93. https://doi-org/10.1111/j.1365-2311.1930.tb01203.x

Fallén CF (1813) Specimen novam Hymenoptera disponendi methodum exhibens. Thesis,
Lund, 41 pp. https://doi.org/10.5962/bhl.title. 106859

Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R (1994) DNA primers for amplification
of mitochondrial cytochrome c oxidase subunit from diverse metazoan invertebrates. Mo-
lecular Marine Biology and Biotechnology 3(5): 294-299.

Gillespie JJ, Yoder MJ, Wharton RA (2005) Predicted secondary structure for 28S and 18S
tRNA from Ichneumonoidea (Insecta: Hymenoptera: Apocrita): impact on sequence
alignment and phylogeny estimation. Journal of Molecular Evolution 61(1): 114-137.
https://doi.org/10.1007/s00239-004-0246-x

Goémez Duran JM, van Achterberg C (2011) Oviposition behaviour of four ant parasitoids
(Hymenoptera, Braconidae, Euphorinae, Neoneurini and Ichneumonidae, Hybrizonti-
nae), with the description of three new European species. ZooKeys 125: 59-106. https://
doi.org/10.3897/zookeys. 125.1754

He J-H (1981) A new record of Hybrizonidae (Hymenoptera) from China. Journal of Zhejiang
Agricultural University 7(3): 1-89.

26 Jing-Xian Liu et al. / Journal of Hymenoptera Research 72: 11-26 (2019)

Hisasue Y, Konishi K (2019) A new genus of the subfamily Hybrizontinae (Hymenoptera: Ichneu-
monidae) from Japan. Zootaxa 4664(2): 241-250. https://doi.org/10.11646/zootaxa.4664.2.6

Katoh K, Standley DM (2013) MAFFT multiple sequence alignment software version 7: im-
provements in performance and usability. Molecular Biology and Evolution 30, 772-780.
https://doi.org/10.1093/molbev/mst010

Konishi K, Choi M-B, Lee J-W (2012) Review of the East Asian species of the genera Hybrizon
Fallén and Ghilaromma Tobias (Hymenoptera: Ichneumonidae: Hybrizontinae). Entomo-
logical Research 42: 19-27. https://doi.org/10.1111/j.1748-5967.2011.00352.x

Quicke DLJ, Fitton MG, Notton DG, Broad GR, Dolphin K (2000) Phylogeny of the sub-
families of Ichneumonidae (Hymenoptera): a simultaneous molecular and morphological
analysis. In: Austin AD, Dowton M (Eds) Hymenoptera: evolution, biodiversity and bio-
logical control. CSIRO Publishing, Collingwood, 74-83.

Quicke DLJ, Laurenne, NM, Fitton MG, Broad GR (2009) A thousand and one wasps: a 28S
rDNA and morphological phylogeny of the Ichneumonidae (Insecta: Hymenoptera) with
an investigation into alignment parameter space and elision. Journal of Natural History
43(23-24): 1305-1421. https://doi.org/10.1080/00222930902807783

Rasnitsyn A (1980) The origin and evolution of Hymenoptera. Trudy Paleontologicheskogo
Instituta 174: 1-190. [in Russian]

Sharkey M, Wahl D (1987) Phylogeny of the Ichneumonoidea. Ichnews 10: 4-10.

Taekul C, Valerio AA, Austin AD, Klompen H, Johnson NF (2014) Molecular phylogeny of
telenomine egg parasitoids (Hymenoptera: Platygastridae s.l.: Telenominae): evolution of
host shifts and implications for classification. Systematic Entomology 39: 24-35. https://
doi.org/10.1111/syen.12032

Tobias VI (1988) [The family Paxylommatidae (Hymenoptera) in the fauna of the USSR.]
Trudy Vsesoyuznogo Entomologicheskogo Obshchestva 70: 131-143. [in Russian]

van Achterberg C (1976) Hybrizontinae or Hybrizontidae? (Hymenoptera, Ichneumonoidea).
Entomologische Berichten Amsterdam 36: 61-64.

van Achterberg C (1988) Revision of the subfamily Blacinae Foerster (Hymenoptera, Braconi-
dae). Zoologische Verhandelingen Leiden 249: 1-324.

van Achterberg C (1999) The West Palaearctic species of the subfamily Paxylommatinae (Hy-
menoptera: Ichneumonidae), with special reference to the genus Hybrizon Fallén. Zoolo-
gische Mededelingen Leiden 73: 11-26.

van Achterberg C, You L-S, Li X-Y (2013) Hybrizon Fallén (Hymenoptera, Ichneumonidae,
Hybrizoninae) found in Hunan (China). Journal of Hymenoptera Research 30: 65-74.
https://doi.org/10.3897/jhr.30.3182

Wahl D, Sharkey M (1988) Rejoinders at various quarters. Ichnews 11: 12-17.

Wharton RA, van Achterberg C (2000) Family group names in Braconidae (Hymenoptera:
Ichneumonoidea). Journal of Hymenoptera Research 9: 254-270.

Yu DS, Horstmann K (1997) A catalogue of world Ichneumonidae (Hymenoptera). Memoirs
of the American Entomological Institute 58: 1—-1558.

Yu DS, van Achterberg C, Horstmann K (2016) Taxapad 2016, Ichneumonoidea 2015. Data-
base on flash-drive, Nepean. http://www.taxapad.com