ote

JHR 32: I-I 5 (20 I 3) JOURNAL COR. Peetresiewed open atontiloureal
eae (4) Hymenoptera

www.pensoft.net/journals/jhr The iternaonl Society of Hymenoptxriss, RESEARCH

Phylogeny of hornets: a total evidence approach
(Hymenoptera, Vespidae, Vespinae, Vespa)

Adrien Perrard', Kurt M. Pickett??, Claire Villemant',

Jun-ichi Kojima’, James Carpenter*

| MNAN, Muséum National d'Histoire Naturelle, UMR 7205, Equipe variation, CP50, 75005, Paris, Fran-
ce 2 Department of Biology, University of Vermont, Room 120A Marsh Life Science Building, 109 Carrigan
Drive, Burlington, VT 05405, USA 3 Natural History Laboratory, Faculty of Science, Ibaraki University,
Mito 310-8512, Japan 4 Division of Invertebrate Zoology, American Museum of Natural History, New York,
NY 10024, USA

Corresponding author: Adrien Perrard (perrard@mnhn.fr)

Academic editor: W. Pulawski | Received 15 January 2013 | Accepted 14 March 2013 | Published 24 April 2013

Citation: Perrard A, Pickett K, Villemant C, Kojima J-I, Carpenter J (2013) Phylogeny of hornets: a total evidence
approach (Hymenoptera, Vespidae, Vespinae, Vespa). Journal of Hymenoptera Research 32: 1-15. doi: 10.3897/
JHR.32.4685

Abstract

The only previous comprehensive phylogenetic analysis of the 22 species of the genus Vespa was based
on just 11 morphological characters and resulted in only limited resolution. In order to improve the
phylogenetic inference, we carried out a simultaneous analysis with 45 morphological characters and data
from four mitochondrial and two nuclear genes. The results support a number of the previously found
relationships. Ihe monophyly of the genus Vespa and the existence of a main clade excluding V. basalis and
V. binghami are confirmed. The tropica group is supported. The affinis group is not supported; molecular
data relate the previously unresolved V. orientalis to V. affinis + V. mocsaryana.

Keywords
Hornet, Phylogeny, Total Evidence, Vespidae

Introduction

The genus Vespa is one of the four genera of the subfamily Vespinae; it is composed
of 22 extant species of hornets (Archer 1991, Nguyen et al. 2006). Most species have
a distribution restricted to Asia, with the highest diversity found in northern Indo-

Copyright Adrien Perrard et al. This is an open access article distributed under the terms of the Creative Commons Attribution License 3.0
(CC-BY), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

2 Adrien Perrard et al. / Journal of Hymenoptera Research 32: 1-15 (2013)

Malaya (Matsuura and Yamane 1990, Carpenter and Kojima 1997). Two species are
also naturally distributed outside of Asia: Vespa crabro is found in Europe and around
the Black Sea and the Caspian Sea and V. orientalis in the north of Africa, Mediter-
ranean regions and across the Middle-East. In the mid-19th century V. crabro was
introduced into North America where it is now established (de Saussure 1898), while
more recently, V. velutina was accidentally introduced into Europe, where it became
invasive (Villemant et al. 2011). Several hornet species have been the subject of various
biological studies, either because of their social habits (Matsuura 1991, Foster et al.
2000, Ishay et al. 2008), their threat to human health (Vetter et al. 1999), their impact
on apiculture (Abrol 1994, Ranhabat et al. 2009) or even their interest as edible insects
(Ying et al. 2010). However, the phylogeny of this genus is not yet well resolved.

The first cladistic study of Vespa was that of Archer (1994a), based on 11 mor-
phological characters (10 binary and one multistate). It distinguished a main clade
comprising most Vespa species, and two species unresolved at the base of the entire tree
(Fig. 1). One of them, V. binghami, is the only Vespa species presenting morphological
adaptation to nocturnal habits (van der Vecht 1959). The other unplaced species of
Archer’s cladogram, V. basalis, is a small hornet readily distinguishable by its reduced
punctation, especially on the clypeus. The main clade found by Archer (1994a) pre-
sented an unresolved basal node with four lineages, one comprising a single species (V.
orientalis) and a second he termed the crabro group (V. crabro and V. dybowskii). The
third lineage, or tropica group, included five species in two clades: one with V. man-
darinia + V. soror, and the other with three species (V. ducalis, V. philippinensis and V.
tropica). Archer's last lineage, called the affinis group (Fig. 1), was composed of the 12
remaining species including an unresolved clade of four species which have very similar
morphology (V. bicolor, V. simillima, V. velutina and V. vivax). This unresolved clade
was termed the bicolor group by Archer in another paper (1994b) and was sister-group
of two unresolved species from so-called Sundaland: V. bellicosa and V. multimaculata.

Archer's study was based mostly on male characters, which are known to be reliable
phylogenetic characters (e. g. Song and Bucheli 2010), but his cladogram has many un-
resolved relationships. Furthermore, some of the lineages are only supported by single
characters from female morphology, such as the tropica group, which is characterized
by the female clypeus shape. Corroborating such groups thus requires further analyses.

This study presents results from an ongoing project on the evolution of vespine
wasps, focusing on the genus Vespa. Our aims are to confirm the monophyly of the genus
Vespa, a question not addressed by Archer (1994a), and to clarify relationships among the
species based on a more extensive morphological matrix and combining molecular data.

Methods

Phylogenetic relationships were inferred for the 22 species of the genus Vespa and five
other species of Vespidae as outgroup: Dolichovespula media (Retzius, 1783), Provespa
anomala (de Saussure, 1854), Provespa barthelemyi (du Buysson, 1905) and Vespula ger-

Phylogeny of the genus Vespa 3

V. basalis Smith, 1852
V. binghami du Buysson, 1905
V. orientalis L., 1771
V. crabro L., 1758
@ V. dybowskii André, 1884

V. soror du Buysson, 1905
V. mandarinia Smith, 1852

@ V. ducalis Smith, 1852
V. philippinensis de Saussure, 1854
V. tropica (L., 1758)
V. fumida van der Vecht, 1959
V. analis Fabricius, 1775

@ V. mocsaryana du Buysson, 1905
V. affinis (L., 1764)
V. luctuosa de Saussure, 1854
V. fervida Smith, 1858
V. bellicosa de Saussure, 1854
V. multimaculata Pérez, 1910
V. bicolor Fabricius, 1787
V. simillima Smith, 1868
@ V. velutina Lepeletier, 1836
V. vivax Smith, 1870
Figure |. Phylogeny of the genus Vespa after Archer (1994a: figure 8). Tree updated for the current

classification (Nguyen et al. 2006). The species groups discussed in this paper are as follows: | crabro
2 tropica 3 affinis 4 bicolor sensu Archer (1994b).

manica (Fabricius, 1793) from the subfamily Vespinae and Polistes dominula (Christ,
1791) from the Polistinae.

The morphological matrix was scored from specimens in the following natural his-
tory collections: American Museum of Natural History, Muséum National d Histoire
Naturelle, Nationaal Natuurhistorisch Museum and United States National Museum
of Natural History. Specimens for molecular study were collected by J.K. and J.M.C.
and preserved in 95 - 99% ethanol.

DNA was extracted from one leg and one antenna per specimen using QIAGEN
“DNeasy tissue Kit”. Genes were amplified using PCR with PuReTaq Ready-To-Go
beads in a total volume of 25uL including primers (Appendix 1) and DNA. Amplifica-
tion cycles were specific to genes (Appendix 2). AMPures and CleanSEQ procedures
were used for DNA purification and sequencing was performed on ABI PRISM 3730xl
machines by Agencourt Biosciences (Beverly, USA). One missing gene fragment of V.
basalis was obtained from Genbank database (accession number: AB585949).

The analyses are based on 45 morphological characters and multiple nuclear and
mitochondrial loci, comprising: 374 sites of 12S, 528 sites of 16S, 2231 sites of 28S
(sequenced in 4 fragments), 1442 sites of CO1 (sequenced in 2 fragments), 880 sites
of elongation factor lx (EFl«), and 328 sites of H3. Each of these genes was aligned

4 Adrien Perrard et al. / Journal of Hymenoptera Research 32: 1-15 (2013)

separately using the MAFFT software with the L-INS-i algorithm (Katoh et al. 2005).
Morphological characters were coded with Winclada V. 1.00.08 (Nixon 2002).

Phylogenetic analyses were performed in a parsimony framework using TNT
(Goloboff et al. 2008). Analyses were first conducted on the morphological matrix
and on the different molecular datasets separately, then on a matrix of all the data
combined. Sequence alignments were merged with Winclada, and the final composite
molecular matrix contained 5783 aligned nucleotides. Each analysis was performed
with the new technology search algorithms including sectorial searches, the parsimony
ratchet, tree drifting and tree fusing, default parameters except: 200 ratchet iterations,
upweighting percentage 8, downweighting 4; 50 cycles of drift; minimum length hit
25 times. Molecular gaps were treated as missing data. Node supports were computed
as GC-values of a symmetric resampling of 1000 replicates (group supported/contra-
dicted values; Goloboff et al. 2003). GC values range from -1 to 1 and are the differ-
ences in group frequency between the group found in most parsimonious trees and the
most frequent contradictory group. Only supported groups (support value above zero,
scaled by TNT 0-100) are shown.

Results

Morphological analysis

Analysis of the 45 morphological characters (Appendix 3) resulted in a single most
parsimonious tree (not shown; Length: 107, Consistency Index (CI): 0.617, Reten-
tion Index (RI): 0.784). The support tree is shown in Fig. 2. The only difference is that
the most parsimonious cladogram resolves V. orientalis as the sister species to the clade
composed of mandarinia + soror and the affinis group; the support tree (Fig. 2) does
not include this node. On both trees the genus Vespa appears as monophyletic, and
V. basalis the sister species of the rest of the genus, followed by V. binghami. The 20
remaining species are grouped in three clades, relationships among which are not re-
solved (Fig. 2): a clade with only V. orientalis, the second comprising crabro + dybowskii
together with V. tropica and its two closely related species, and the third clade with the
remaining 14 species. The tropica group sensu Archer (1994a) is thus not monophyletic
according to these morphological data: V. mandarinia + V. soror are not closely related
to V. tropica, rather they form the sister group of what corresponds to the affinis group
of Archer. Finally, V. bellicosa and V. multimaculata are internal components of a clade

including the four species of the bicolor group sensu Archer (1994b).

Molecular analyses

Of the 27 studied species, specimens relatively recently collected were available for
17 species (including the outgroups). Due to low quality DNA templates and the use

Phylogeny of the genus Vespa

100

94

73

49

14
27

31

21

45

16

65

76

25

68

70

66

12

84

23

96

27

Polistes dominula
Provespa barthelemyi
Provespa anomala
Vespula germanica
Dolichovespula media
Vespa basalis

Vespa binghami
Vespa orientalis
Vespa dybowskii
Vespa crabro

Vespa tropica

Vespa philippinensis
Vespa ducalis

Vespa soror

Vespa mandarinia
Vespa fumida

Vespa analis

Vespa mocsaryana
Vespa affinis

Vespa lutuosa

Vespa fervida

Vespa vivax

Vespa multimaculata
Vespa bellicosa
Vespa bicolor

Vespa velutina

Vespa simillima

Figure 2. Support tree for relationships among the 22 Vespa species based on 45 morphological charac-

ters. Supports for nodes are given in GC-values (see text for explanation) when they are greater than zero.

of non-specific primers, molecular data are not homogeneous across the genus. The
monophyly of the genus Vespa was found in most analyses based on single genes and

in the analysis of merged alignments (Table 1, Fig. 3). The main species-groups appear
monophyletic over most analyses except for the low variation 28S. Vespa basalis re-
mains the basal species in the genus. Two main clades diverge in the remaining species:
the monophyletic tropica group is the first clade, while the bicolor group and a clade of
V. crabro, V. mocsaryana and V. affinis form the second. The bicolor group sensu Archer
(1994b) is supported in all molecular analyses, with V. vivax being resolved as the sister

species of V. velutina.

6

Adrien Perrard et al. / Journal of Hymenoptera Research 32: I-15 (2013)

Table |. Results of phylogenetic analyses of molecular data for the genus Vespa. Marker: gene used in the

analysis. “Multi-locus” marker is a combination of all genes used. N tree: number of most parsimonious

trees. Length: length of the most parsimonious trees. Vespa, bicolor, mandarinia, tropica: monophyly of

the considered clade when it is tested.

marker | Ntree | length cr | RE | Vespa | bicolor | mandarinia | erapicn
12S 5 261 yes yes = :
aes =
28S | >1000 | 145 no
COl 1 1431 | 0.508 | 0.369 yes yes :
EFla 1 219 | 0.886 | 0.819 yes yes
HB 1 81 | 0.889 | 0.690 yes :
ee 207 | 2494 | 0.620 | 0.468 | yes us i uF
112222 CCHE
268888003 F
S.5°S15 S°S)1a. 71
123412 a
P.dominda QQ GRRE
Vi.germanica QAR RRHEE O
Poarthelemy RRR RRREHHE
'00.— Panomaia QRRREEEE &
D. media TRI l i
10 V. basalis a FT TLL
3 V. tropica | ae |
99 V. ducalis Sh Ga
91 73 V.mandarinia QR REREEE
96 V. soror FT TTT wo
V. crabro TTT
76 Vorientalis [RRR
99 V. affinis ie
51 V. bicolor BERR
100 V. simillima f 6€6© URED
69 V. vivax EEREREE
100 V. velutina a [| [4 [4 a LI

Figure 3. Support tree for the relationships among 13 Vespa species based on the six genes. Supports

for nodes are given in GC-values. Grey rectangles show the molecular markers available for each species.

Phylogeny of the genus Vespa 7

Total evidence analysis

The combined analysis of morphological and molecular data returned eight equally
parsimonious trees all showing Vespa monophyletic with V. basalis as the sister species
of the rest of the genus (not shown; Length: 2665, CI: 0.608, RI: 0.488). The con-
sensus tree (not shown) is completely resolved except for a node including the bicolor
eroup, V. bellicosa and V. multimaculata. In the support tree (Fig. 4), two internal
nodes are collapsed, because of a different position of V. fumida.

The monophyly of the genus is supported by five synapomorphies: the long pres-
tigma, the developed vertex, the strongly elevated interantennal space, the presence of
a carina on the hindcoxa, and the projection at the apex of the digitus in males.

The addition of molecular data to the morphological matrix resulted in stronger
support of the tropica group and resolved the position of V. orientalis, as part of a
clade with two morphologically different species, V. affinis and V. mocsaryana, close to
V. crabro. The affinis group sensu Archer (1994a) thus did not appear monophyletic.
These changes resulted in fewer steps for the morphological character of the clypeal
apical margin, a synapomorphy of the tropica group, while the Cls of eight other mor-
phological characters (five pronotal and head characters and three male characters)
diminished.

In the combined analysis tree, most of the clades of Vespa species are supported
by morphological characters, five of which are uncontroverted synapomorphies. Vespa
basalis is distinguished from the other species on the basis of the aedeagal apical lobes
in males and the edges of the interantennal space. The main clade excluding V. basalis
and V. binghami is supported by the clypeal punctures dense mesally in females and the
emarginated apical margins of the metasomal sterna VI and VII in males.

Within the main Vespa clade, the tropica group is morphologically supported by
the triangular apico-lateral angles of female clypeus only, but molecular data confirms
this homology. Within this group, V. mandarinia + V. soror is defined by two uncon-
troverted characters: the spade-shape of the aedeagus apex in males and the expansion
of the gena behind the eyes. The three other species of the tropica group share the
presence of pronotal striae, long first metasomal segment and marked scutal and meta-
pleural punctures.

The two species of the crabro group share two secondary reversions: the straight
apical margin of the male metasomal sternum VI and the loss of digital apical process.
Vespa affinis and V. mocsaryana share the posteromedially deeply emarginated male
metasomal sterna VI and VII and long first metasomal segment. ‘The clade consisting
of V. orientalis and V. affinis + V. mocsaryana is supported by the short malar space, a
homoplastic synapomorphy found also in the clade of V. analis, V. luctuosa + V. fervida,
V. multimaculata, V. bellicosa and the bicolor group. ‘This latter clade is also supported
by the bulbous aedeagal shaft in males. The clade of these species but V. analis is mor-
phologically supported by a pretegular carina ventrally effaced, the presence of a few
ventral striae on the female pronotum and the apical margin of the male metasomal
sternum VII deeply emarginate. Vespa fervida + V. luctuosa is supported by the well

8 Adrien Perrard et al. / Journal of Hymenoptera Research 32: I-15 (2013)

53
39
100

96
95
79 42
80

50 68

10 95
26

D3

11

PI. dominula
VI. germanica
D. media

P. barthelemyi
P.anomala

V. basalis

V. binghami

V. fumida

V. soror

V. mandarinia
V. philippinensis
V. tropica

V. ducalis

V. dybowskii

V. crabro

V. orientalis

V. mocsaryana
V. affinis

V. analis

V. luctuosa

V. fervida

V. multimaculata
V. bellicosa

V. bicolor

V. simillima

V. vivax

V. velutina

Figure 4. Support tree for the relationships within the genus Vespa based on a combined analysis. Sup-

port tree based on 45 morphological characters and six genes. Black nodes indicate clades supported by

morphological characters. Absence of mark on nodes indicates clades diagnosed by molecular data only.

Supports for nodes are given in GC-values.

defined punctures on metapleura and lateral faces of the metasomal tergum II as well

as the uncontroverted synapomorphy of the median process in the apical margin of the

metasomal sternum VII. Finally, the clade of the bicolor group and V. multimaculata
and V. bellicosa is supported by the distinct interruption of the pronotal carina by the

pronotal pit. The four remaining clades within the genus Vespa are not diagnosed by

morphological characters. These latter clades also have low support under symmetric

resampling (Fig. 4).

Phylogeny of the genus Vespa 9

Discussion

Our analyses of both morphological and molecular characters confirm the monophyly
of the genus Vespa. This genus was first diagnosed from other Vespidae on the basis of
the shape of the head (Thomson 1869) and especially the vertex length, which is con-
gruent with the other synapomorphies of the genus. In our morphological and total
evidence analyses, the genus Vespa is the sister-group to the other vespine genera with
similar relationships to those described by Carpenter (1987). The results of Carpenter
(1987) based on morphology and ours based on combined analysis contradict Pickett
and Carpenter (2010).

While our molecular sample is incomplete, it nonetheless confirms the monophyly
of two of Archer’s species groups within Vespa based on the morphology (crabro and
tropica groups). Molecular data help to place V. orientalis, which both Archer’s and
our morphological analyses failed to resolve well. Vespa orientalis is the only Vespa spe-
cies distributed in arid areas in central Asia and the Middle-East. A close relationship
of this species to V. affinis + V. mocsaryana despite obvious morphological differences
begs the question of morphological adaptations to arid climates in V. orientalis that
may have blurred the morphological phylogenetic signal. However, the close relation-
ship of V. orientalis and V. affinis is suggested only by the 12S gene in the molecular
data. Further gene sequences for this last species and for V. mocsaryana are necessary
to clarify whether the clade consisting of V. orientalis and V. affinis + V. mocsaryana is
definitively supported.

Our results are also consistent with previous authors regarding the close relation-
ships of V. luctuosa and V. fervida, which are very similar in their morphology (van
der Vecht 1957, Archer 1994a, 1999). On the other hand, V. bellicosa and V. multi-
maculata, for which close relationships to V. /uctuosa were suggested based on their
distribution and morphological similarities (Bequaert 1934), are not closely related to
V. luctuosa. They appear to form a clade together with Archer's bicolor group. Relation-
ships within this last clade are still poorly resolved with low node supports. Molecular
data showed a closer relationship between V. vivax and V. velutina (Fig. 3), while the
morphological characters placed V. simillima and V. velutina as sister species. Such a
discrepancy may have resulted from the fact that no molecular data were available for
V. multimaculata and V. bellicosa.

Archer's finding of a main clade of Vespa excluding V. basalis and V. binghami has
been confirmed both by morphological and molecular data. Our results also suggest
that the nocturnal species V. binghami is closer to the main clade of Vespa than is V. basa-
lis. Morphological adaptations to nocturnal habits in V binghami such as enlarged ocelli
are thus autapomorphies. Recognition of the subgenus Vyctovespa, with V. binghami as
sole included species (van der Vecht 1959), would thus render the subgenus Vespa para-
phyletic, and the synonymy of Nyctovespa (Carpenter 1987) is justified on that basis.

Our extended morphological matrix and the molecular sequences partly support
Archer's results, and this analysis confirms that male characters such as the shape of the
last metasomal sterna and the genitalia are reliable phylogenetic characters in Vespidae.

10 Adrien Perrard et al. / Journal of Hymenoptera Research 32: I-15 (2013)

Acknowledgments

We thank B. Baliff, and M. Cunningham from the University of Vermont and E Jacquet
from the Muséum National d’Histoire Naturelle for assistance with obtaining the mo-
lecular data. This work benefited from NSF grant DEB-0843505. The first author ben-
efited from an Annette Kade Fellowship from the American Museum of Natural History.

References

Abrol DP (1994) Ecology, behaviour and management of social wasp, Vespa velutina Smith (Hy-
menoptera: Vespidae), attacking honeybee colonies. Korean Journal of Apiculture 9: 5—10.

Archer ME (1991) The number of species that can be recognized within the genus Vespa (Hym.,
Vespinae). Entomologist’s Monthly Magazine 127: 161-164.

Archer ME (1994a) A phylogenetic study of the species of the genus Vespa (Hymenoptera: Vespi-
nae). Insect Systematics and Evolution 24: 469-478. doi: 10.1163/187631293X00226

Archer ME (1994b) Taxonomy, distribution and nesting biology of the Vespa bicolor group
(Hym., Vespinae). Entomologist’s Monthly Magazine 130: 149-158.

Archer ME (1999) Taxonomy, distribution and nesting biology of Vespa binghami, V. basalis,
V. variabilis, V. fervida, V. luctuosa, V. multimaculata and V. bellicosa (Hym., Vespinae).
Entomologist’s Monthly Magazine 135: 43-50.

Bequaert J (1934) Les races de coloration de Vespa luctuosa de Saussure et de Polistes tenebricosus
Lepeletier. Bulletin du Musée Royal d’Histoire Naturelle de Belgique 10: 1-11.

Carpenter JM (1987) Phylogenetic relationships and classification of the Vespinae (Hymenop-
tera: Vespidae). Systematic Entomology 12: 413-431. doi: 10.1111/j.1365-3113.1987.
tb00213.x

Carpenter JM, Kojima J (1997) Checklist of the species in the subfamily Vespinae (Insecta:
Hymenoptera: Vespidae). Natural History Bulletin of Ibaraki University 1: 51-92.

Foster KR, Ratnieks FLW, Raybould AF (2000) Do hornets have zombie workers? Molecular
Ecology 9: 735-742. doi: 10.1046/j.1365-294x.2000.00920.x

Goloboff PA, Farris JS, Kallersjs M, Oxelman B, Szumik CA (2003) Improvements to re-
sampling measures of group support. Cladistics 19: 324-332. doi: 10.1111/j.1096-
0031.2003.tb00376.x

Goloboff PA, Farris JS, Nixon KC (2008) TNT, a free program for phylogenetic analysis. Cla-
distics 24: 1-13. doi: 10.1111/j.1096-0031.2008.00217.x

Ishay JS, Barkay Z, Eliaz N, Plotkin M, Volynchik S, Bergman DJ (2008) Gravity orientation
in social wasp comb cells (Vespinae) and the possible role of embedded minerals. Naturwis-
senschaften 95: 333-342. doi: 10.1007/s00114-007-0334-z

Katoh K, Kuma K, Toh H, Miyata T (2005) MAFFT version 5: improvement in accuracy of
multiple sequence alignment. Nucleic Acid Research 33: 511-518. doi: 10.1093/nar/gki198

Matsuura M, Yamane S (1990) Biology of the vespine wasps. Springer Verlag (Berlin): 1-323.

Matsuura M (1991) Vespa and Provespa. In: KG Ross, RW Matthews (Eds) The social biology
of wasps. Cornell University Press, Ithaca, 232-262.

Phylogeny of the genus Vespa 11

Nguyen LIP, Saito K Kojima J, Carpenter JM (2006) Vespidae of Viet Nam (Insecta: Hyme-
noptera) 2. Taxonomic notes on Vespinae. Zoological Science 23: 95-104. doi: 10.2108/
25).23.95

Nixon KC (2002) WinClada, version 1.00. 08. Published by the author, Ithaca, New York.

Pickett KM, Carpenter JM (2010) Simultaneous analysis and the origin of eusociality in the
Vespidae (Insecta: Hymenoptera). Arthropod Systematics and Phylogeny 68: 3-33.

Ranabhat NB, Tamrakar AS (2009) Study on seasonal activity of predatory wasps attacking
honeybee Apis cerana Fab. Colonies in Southern Belt of Kaski District, Nepal. Journal of
Natural History Museum 23: 125-128.

de Saussure H (1898) A species of Orthoptera. Entomological News 9: 144-145.

Song H, Bucheli SR (2010) Comparison of phylogenetic signal between male genitalia and
non-genital characters in insect systematics. Cladistics 26: 23-35. doi: 10.1111/j.1096-
0031.2009.00273.x

Thomson CG (1869) Ofversigt af Sveriges Vespariae. Opuscula Entomologica 1: 78-82.

van der Vecht J (1957) The Vespinae of the Indo-Malayan and Papuan areas (Hymenoptera,
Vespidae). Zoologische Verhandelingen 34: 1-82.

van der Vecht J (1959) Notes on Oriental Vespinae, including some species from China and
Japan (Hymenoptera, Vespidae). Zoologische Mededelingen 13: 205-232.

Vetter RS, Visscher PK, Camazine S (1999) Mass envenomations by honey bees and wasps.
Western Journal of Medicine 170: 223-227.

Villemant C, Barbet-Massin M, Perrard A, Muller F Gargominy O, Jiguet F Rome Q (2011)
Predicting the invasion risk by the alien bee-hawking Yellow-legged hornet Vespa velutina
nigrithorax across Europe and other continents with niche models. Biological Conservation
144: 2142-2150. doi: 10.1016/j.biocon.2011.04.009

Ying E Xiaoming C, Long S, Zhiyong C (2010) Common edible wasps in Yunnan Province,
China and their nutritional value. In: Durst PB, Johnson DV, Leslie RN, Shono K (Eds)
Forest insects as food: humans bite back. Bangkok FAO (Bangkok), 93 pp.

12 Adrien Perrard et al. / Journal of Hymenoptera Research 32: 1-15 (2013)

Appendix |

Primers used for sequencing the six genes.

Marker

Sequence (5’-3’)
AAACTAGGATTAGATACCCTATTAT

12S B 125A
128 12S BI

R AAGAGCGACGGGCGATGTGT
16S CGCCTGTTTATCAAAAACAT
16S R 16S B CTCCGGTTTGAACTCAGATCA

285-1 F 28S 1A CCCSCGTAAYTTAGGCATAT

288-1 R 28S 4 BR CETIGCTECETGITICAAGNC

288-2 AGTACGTGAAACCGTTCASGGGT

28S-2 TCGGAAGGAACCAGCTACTA

288-3 F GGAGTCTAGCATGTGYGCAAGTC

288-3 R CCACAGCGCCGATTCTGCTTACC

28S-4 F ACCTATTCTCAAACTTTAAATGG

285-4 GACTTCCCTTACCTACAT

CO1-1 GGTCAACAAATCATAAAGATATTGG

eGia R HCO out out GTAAATATATGRIGDGCTC

CO1-2 F Jerry CAACATTTATTTTGATTTTTTGG

CO1-2 R P TCCAATGCACTAATCTGCCATATTA

at
EFle | EF | HaF2For

F GGGYAAAGGWTCCTTCAARTATGC
EF lo R F2Rev1 AATCAGCAGCACCTTTAGGTGG
ob F H3-AF ATGGCTCGTACCAAGCAGACVGC
H3 R H3-AR GTCACYATYATGCCYAAGGATAT
Appendix 2

PCR program of each marker with temperature and time (°C — minute). Den. = Denaturing phase. An-
neal. = Annealing phase. Elong. = Elongation phase. N = number of cycles of Denaturing + Annealing +

Elongation phases.

Marker Anneal. Elong. N
12S 42 — 0.75 68 — 0.5 40
16S 42. —0:5 72—0.5 40

28S-1 43.5 —0.5 72-1 40

28S-2 43.5 —0.5 72-1 40

28S-3 43.5 —0.5 72-1 40

28S-4 40 —0.5 72-1 40

CO1-1 36/51-0.5 72-0.5 5/35

CO1-2 36/ 48-1 72-1 535

EF lo 54-1 72—1.5 ro
H3 51-0.5 72 —0.75 40

Phylogeny

Appendix 3

of the genus Vespa 13

Matrix of morphological characters. Outgroup species are in grey.

000000000111111

1122222222223333333333444444

V, mandarinia

V. mocsaryana

V. multimaculata

22001002 Ou 023102 -02 1
2 OleOle? 1) OOe3 s1 el eO.L
20. IO UGL 209 14 O20-7% TO

1.0201 O°0-O20.1. Ty dds do, lite 1-0-0341 1, 0°34 1-021 00
1402018 00-1605 Lek: dell dole ele 0° 2925 Oe el 0-10
14.0, O TL alselt 20g Tandy alee tT sl elle Q 20822. QaclMel TL slelklO

V. orientalis

2 OL OL 101107013: LelOe10

100: 0-0-050-0F1s 11 delat ls 0s Oa Os bel 0-0

Teeth
Chana WEZAS ECTS OOLISA SG. BF 890129 FR 679 90175 45-6 789 034s
P dominuh 000000000000000 0 1 .0000000000000000010000000000
D. media Tne Ualesiincaar Teter onlm Meee OE Ofte Mall Utabg Bre okey ee. MM anon almmnlG(oheleopaicter ie vuistioe aime
Vi germanica =|111111200011200 0 0 113--20111111111100010601000
P anomala Ties Vlei ieee SUR ule We(SiO mason Mu eeaionmontek lat gpl olmmalscontscugomenem scr ale Dine) a0
P barthelemyi |111111000111100 0 0 102-020011111110010000401000
V. affinis JOLOLPOLOO2LLOinO Ort hOO COLO TLITA De ht foe so Litt to
V. analis 20 LOUIOLOOSL ED TOsi-o 2OO DOMOO Saat 12, boo 1S OM ae. Peo
V. basalis Z0LOTLOIIO21100 0 1 10070100111 11112100000201010
V. bellicosa FOL OLLOLOO Dt POAeO dsl GOL La Ohba tt do tro one Ona Preto
V. bicolor 20LOTLOMOOS11O0 0 O 1001 LOd DAD IMI TO02 Sorta 6
V binghami = |201011110131100 0 0 1000000011111111100000111010
V. crabro SOiOA 10 hos Ooo Oo Ooo dll wea isO-0c0 hom Temoro
V. ducalis SOTOLUOLOOIMOOL eh 1 TOC OUT 02a aed tod Poa a Ot
V dybowskii =|201011010031101 1 1 1000001011111111100010111000
V, fervida POLOLTIONOCSL LOI CADDO DODO IAaD TD etood 214d DO
V; fumida ZOLO1LOL0031100 1» 1 LOOTOOO0TLTIIT1IT1100120111011
V. luctuosa 201011010021101 0 60 1001021021111121101211111210

ie Pal

0 0

0 0

/1 0

dad

dv

am Pat

a

ie

0 0

V. philippinensis 201011010031201 TUG CaO Ogos Lilt ltel Rio iy Tele Del Osea eG)
V. simillima 201011010031100 PGA Et Sea le ty Et 030 Dae Ocled At 1
V. soror 70 OE AO: 0 053 OsOat fj t O00. Oats 1 Ae elo (030-1 3 OO
V, tropica F Os Gah ALO 1 O03 te Ps0et AGH 0. CaleO.D at tehed. OR OO Gukk Arora
V. velutina 20 al LODO OSL L O-0 PO Gasiehil Osim det thin hiro psec f Aeeo
V. vivax BD (eouinteo Ok Sst OL OO titer, ie Lal tt tet Oates aeOaial tA piRO
Morphological codes

(F / M): character restricted to Females / Males

1. Prestigma length: (0) prestigma shorter than pterostigma, (1) prestigma longer
than pterostigma, (2) prestigma length 3X pterostigma length.

2. Base of second submarginal cell: (0) M obliquely oriented with respect to m-cul,
(1) M vertically oriented (angle at M noticeable).

al

Placement of forewing m-cu2: (0) close to r-m2, (1) far from r-m2.

4, Hamuli placement: (0) beginning basad of fork of RI&Rs, (1) beginning at fork
R1I&Rs.

NN

Hindwing jugal lobe: (0) present, (1) absent.

6. Hindwing axillary incision: (0) present, (1) absent.

14

Adrien Perrard et al. / Journal of Hymenoptera Research 32: 1-15 (2013)

(M) Tyloides: (0) two on apical flagellomeres, (1) one on apical flagellomeres,
(2) absent.

Vertex length: (0) ocelloccipital distance short, < length of ocellar triangle, (1)
ocelloccipital distance long, > length of ocellar triangle, (2) ocelloccipital distance
long, gena produced behind eye.

Vertex indentation: (0) absent, (1) present.

Ocelli diameter: (0) less than distance between posterior ocellus and eye, (1)
greater than this distance.

Interantennal space: (0) broad, rounded, (1) defined triangular area, (2) strongly
elevated, with rounded edges, (3) defined triangular area strongly elevated, with
sharp edges.

Clypeus dorsum: (0) straight, (1) bisinuate.

(F) Apex of clypeus: (0) pointed, (1) shallowly emarginated, anterior angles blunt,
broad, (2) shallowly emarginated, anterior angles triangular.

(F) Mesal clypeal tooth: (0) absent, (1) present.

(F) Clypeal punctures: (0) sparse, superficial mesally, (1) dense mesally.

(M) Clypeal-eye contact: (0) touching, (1) gap.

(F) Malar space: (0) short, (1) long, > length of penultimate flagellomere.
Mandibular teeth: (0) pointed, (1) with elongate cutting edge, twice length of
apical part.

Labial palpus third segment: (0) with strong seta, (1) without this seta, but with
hairs.

Pronotal carina: (0) present, (1) dorsally reduced, (2) lateral remnants, (3) absent.
Pronotal carina dorsally: (0) largely transverse before scutum, (1) deeply U-
shaped before scutum.

Pronotal carina laterally: (0) little interrupted by the pronotal fovea, (1) widely
interrupted by the pronotal fovea.

Pretegular carina: (0) complete, (1) ventrally effaced, (2) absent.

(F) Pronotal striae: (0) absent, (1) few ventral striae, (2) dense ventral and dorsal striae.
Scutal lamella: (0) present, (1) absent.

Scutal punctures: (0) dense micropunctures, (1) superficial, (2) dense and deep
micropunctures.

Epicnemial carina: (0) present, (1) absent.

Dorsal groove: (0) present, (1) absent.

Scutellum profile in lateral view: (0) bulging, (1) largely flat.

Metanotal orientation: (0) partly vertical, (1) largely vertical (dorsal surface reduced).
Metanotal lobe: (0) absent, (1) posteromedial lobe present.

Metapleural sculpture: (0) striae, (1) superficial punctures ventrally, (2) well-de-
fined punctures ventrally.

Hind coxa carina: (0) absent, (1) present.

Metasomal segment I: (0) rounded in lateral view, (1) sharply angled between
anterior and dorsal faces.

Metasomal segment I length: (0) short, (1) long.

36.
oF.
38.
39.
40.
41.
42.
43,

44.
45,

Phylogeny of the genus Vespa 15

Metasomal tergum II lateral macropunctures: (0) superficial to sparse, (1) dense,
well defined.

(M) Apical margin of metasomal sternum VI: (0) almost straight, (1) shallowly
emarginated, (2) deeply emarginated.

(M) Apical margin of metqasomal sternum VII: (0) convex, (1) shallowly emar-
ginated, (2) deeply emarginated.

(M) Median process of metasomal sternum VII: (0) absent, (1) present.

(M) Aedeagal apex: (0) little differentiated, (1) transverse, projecting laterally, (2)
rounded with subapical processes, (3) spade-shaped, (4) elongate, (5) narrow, (6)
subcircular, (7) triangular.

(M) Aedeagal apical lobes: (0) absent, (1) apex forming expanded lobes.

(M) Aedeagus width: (0) narrow throughout, (1) as wide or wider apically as
medially, (2) narrower apically than medially.

(M) Aedeagal shaft: (0) non-bulbous, (1) bulbous.

(M) Digital apical processes: (0) absent, (1) present.

(M) Inner apical margin of paramere: (0) obtusely angled with aedeagus, (1)
forming right angle to aedeagus.